|
|
Cluster Members Consensus/Exemplar |
GeneChip Array Information |
|
173255_at |
|
C. elegans Genome Array |
|
Nematode |
Probe Design Information |
|
affy.Ce.28078
|
|
Exemplar sequence
|
|
1864154 NCBI
|
|
1864154 /REP_DB=GenBank Identifier /FEA=Transcript Cluster /DEF=ribosomal protein P1 homolog
|
This cluster is supported by a Transcript Cluster. |
Annotation Method Description |
|
This probe set was annotated using the Matching Probes based pipeline to a RefSeq,GenBank identifier using 1 transcript(s). |
|
This is a grade A annotation. |
|
NM_170818(10), U89307(9) |
|
|
|
|
|
NM_170818 NCBI |
Caenorhabditis elegans Ribosomal Protein, Acidic family member (rpa-1) (rpa-1) mRNA, complete cds. |
10/11 |
None |
U89307 NCBI |
Caenorhabditis elegans ribosomal protein P1 homolog mRNA, SL2 trans-spliced, complete cds. |
9/11 |
None |
SNAP00000001189 ENSEMBL |
cdna:SNAP chromosome:CEL140:I:2069131:2069515:-1 |
9/11 |
None |
GENEFINDER00000001212 ENSEMBL |
cdna:GeneFinder chromosome:CEL140:I:2069131:2069515:-1 |
9/11 |
None |
Y37E3.7.1 ENSEMBL |
cdna:known chromosome:CEL140:I:2069084:2069589:-1 gene:Y37E3.7 |
10/11 |
None |
Y37E3.7.2 ENSEMBL |
cdna:known chromosome:CEL140:I:2069084:2069577:-1 gene:Y37E3.7 |
10/11 |
None | |
There are no noteworthy cross hybridizing mRNAs found for this probe set. | |
Genomic Alignment of Consensus/Exemplar Sequence |
|
Wormbase March 2004 |
|
|
|
|
|
chrI:2069089-2069579(-) |
93.16 |
93.16 |
| |
Public Domain and Genome References |
|
|
|
rpa-1
|
|
Y37E3.7
|
|
171766 Entrez gene
|
|
P91913 EMBL-EBI
|
|
CE26658 Wormbase
|
Functional Annotations |
|
|
|
|
ATH1-121501:261578_AT |
60S acidic ribosomal protein P1 (RPP1A) |
at |
CANINE:1583171_X_AT |
similar to ribosomal protein P1 isoform 2 |
cfa |
CANINE:1605796_AT |
similar to ribosomal protein P1 isoform 2 |
cfa |
CANINE_2:CFA.21459.1.S1_AT |
similar to ribosomal protein P1 isoform 2 |
cfa |
CANINE_2:CFA.21459.1.S1_X_AT |
similar to ribosomal protein P1 isoform 2 |
cfa |
DROSOPHILA_2:1623606_AT |
Ribosomal protein LP1 |
dm |
DROSGENOME1:143247_AT |
Ribosomal protein LP1 |
dm |
CHICKEN:GGA.3917.1.S1_S_AT |
ribosomal protein, large, P1 |
gga |
CHICKEN:GGAAFFX.20789.1.A1_AT |
ribosomal protein, large, P1 |
gga |
CHICKEN:GGA.3917.2.S1_A_AT |
Ribosomal protein, large, P1 |
gga |
CHICKEN:GGAAFFX.20789.1.S1_AT |
Ribosomal protein, large, P1 |
gga |
CHICKEN:GGA.3917.3.A1_AT |
Ribosomal protein, large, P1 |
gga |
HG-U133_PLUS_2:200763_S_AT |
ribosomal protein, large, P1 |
hs |
HG-FOCUS:200763_S_AT |
ribosomal protein, large, P1 |
hs |
HG-U133A_2:200763_S_AT |
ribosomal protein, large, P1 |
hs |
HG-U133A:200763_S_AT |
ribosomal protein, large, P1 |
hs |
HUGENEFL:M17886_AT |
ribosomal protein, large, P1 |
hs |
U133_X3P:G4506668_3P_A_AT |
ribosomal protein, large, P1 |
hs |
HG-U95AV2:31956_F_AT |
ribosomal protein, large, P1 |
hs |
HG-U95AV2:31957_R_AT |
ribosomal protein, large, P1 |
hs |
HG-U133_PLUS_2:244191_AT |
Ribosomal protein, large, P1 |
hs |
HG-U133B:244191_AT |
Ribosomal protein, large, P1 |
hs |
U133_X3P:HS.282114.0.A1_3P_AT |
Ribosomal protein, large, P1 |
hs |
MU11KSUBA:U29402_F_AT |
ribosomal protein, large, P1 |
mm |
MG-U74AV2:100694_AT |
ribosomal protein, large, P1 |
mm |
MG-U74AV2:161480_I_AT |
ribosomal protein, large, P1 |
mm |
MOE430A:1416277_A_AT |
ribosomal protein, large, P1 |
mm |
MOUSE430A_2:1416277_A_AT |
ribosomal protein, large, P1 |
mm |
MOUSE430_2:1416277_A_AT |
ribosomal protein, large, P1 |
mm |
MU19KSUBB:TC31904_F_AT |
Ribosomal protein, large, P1 (Rplp1), mRNA |
mm |
MU19KSUBB:TC31904_R_AT |
Ribosomal protein, large, P1 (Rplp1), mRNA |
mm |
RG-U34B:RC_AA945636_AT |
ribosomal protein, large, P1 |
rn |
RAE230A:1371307_AT |
ribosomal protein, large, P1 |
rn |
RAT230_2:1371307_AT |
ribosomal protein, large, P1 |
rn | |
|
|
|
|
|
6412 |
protein biosynthesis |
inferred from electronic annotation |
QuickGO AmiGO |
6414 |
translational elongation |
inferred from electronic annotation |
QuickGO AmiGO |
|
|
|
|
5622 |
intracellular |
inferred from electronic annotation |
QuickGO AmiGO |
5840 |
ribosome |
inferred from electronic annotation |
QuickGO AmiGO |
|
|
|
|
3735 |
structural constituent of ribosome |
inferred from electronic annotation |
QuickGO AmiGO | |
|
|
|
|
|
blast |
NP_740801 |
Ribosomal Protein, Acidic family member (rpa-1) [Caenorhabditis elegans] gb|AAK27864.1| Ribosomal protein, acidic protein 1 [Caenorhabditis elegans] sp|P91913|RLA1_CAEEL 60S acidic ribosomal protein P1 |
1.0E-32 |
blast |
AAB48625 |
ribosomal protein P1 homolog [Caenorhabditis elegans] |
2.0E-32 |
blast |
AAB48625 |
ribosomal protein P1 homolog [Caenorhabditis elegans] |
2.0E-31 |
blast |
NP_740801 |
Ribosomal Protein, Acidic family member (rpa-1) [Caenorhabditis elegans] gb|AAK27864.1| Ribosomal protein, acidic protein 1 [Caenorhabditis elegans] sp|P91913|RLA1_CAEEL 60S acidic ribosomal protein P1 |
2.0E-31 | |
|
|
|
|
|
Pfam |
IPR001813 EMBL-EBI |
Ribosomal protein 60S |
2.0E-36 |
Pfam |
IPR001813 EMBL-EBI |
Ribosomal protein 60S |
6.6E-36 | |
Sequence |
|
>C. ELEGANS:173255_AT
aacccagttactcaagcgttctatcaaacgtttgttctctttggagctaaggcaaaccgc
gcaacttacgattgaagaatggcttcgaaccaagaactggcttgcgtctacgctgctctc
atccttcaagatgacgaggtcgccatcaccggcgagaagatcgctacccttctcaaggcc
gccaacgtcgagttcgagccatactggccaggactcttcgccaaggctctcgagggagtt
gatgtgaagaacctcatcacttctgtctcttccggagccggatctggac
BLASTn GenBank NR |
|
|
|
|
|
|
AACCCAGTTACTCAAGCGTTCTATC |
98 |
147 |
19 |
Antisense |
GCAAACCGCGCAACTTACGATTGAA |
226 |
319 |
70 |
Antisense |
CAAGAACTGGCTTGCGTCTACGCTG |
117 |
185 |
109 |
Antisense |
CGCTGCTCTCATCCTTCAAGATGAC |
42 |
255 |
129 |
Antisense |
CAAGATGACGAGGTCGCCATCACCG |
118 |
185 |
145 |
Antisense |
ACCGGCGAGAAGATCGCTACCCTTC |
416 |
85 |
166 |
Antisense |
GCCAACGTCGAGTTCGAGCCATACT |
601 |
277 |
199 |
Antisense |
TCGAGCCATACTGGCCAGGACTCTT |
154 |
601 |
212 |
Antisense |
TCTTCGCCAAGGCTCTCGAGGGAGT |
63 |
617 |
233 |
Antisense |
TGTGAAGAACCTCATCACTTCTGTC |
211 |
555 |
261 |
Antisense |
GTCTCTTCCGGAGCCGGATCTGGAC |
263 |
467 |
283 |
Antisense | |
|
GenBank | |