[Home] | [Total List]

[173168_s_at] Yeast hypothetical 11.2 KD protein like

Description AV178135_rc /REP_DB=TREMBL Accession /FEA=EST Transcript /REVCOMP /GB=AV178135 /DEF=Caenorhabditis elegans cDNA clone:yk538f10 : 3prime end, single read.
Cluster 6grp_highest_10_10 > 92      6grp_high1_10_10 > 49      4grp_highest_8_8 > 11      4grp_high_8_8 > 55      6grp_highest_nonorm > 76      6grp_total > 39      4grp_total > 48      6grp_highest_sub > Cu      6grp_cgc > 09      6grp_high1_sub > Cu      6grp_cgc_sub > Cu      6grp_total_sub > Cup      4grp_rule_based > L3      

Scale
G range Absolute graph Relative graph Expression Table Dauer Comp.
4 1120
1 2 3 4 range
A 644.8
(-3)
P 		1647
(2.4)
P 		1765
(3)
P 		952.4
(-1.4)
P 		1120
B 925.6
(-2.8)
P 		1560.1
(1.8)
P 		1723.6
(3)
P 		896.8
(-3)
P 		827
C 790.8
(-3)
P 		1182.1
(0.1)
P 		1556.5
(3)
P 		828.1
(-2.7)
P 		766
avr 787.1
(-3) 		1463.1
(1.5) 		1681.7
(3) 		892.4
(-2.3) 		895

1 : 1 state (S1, L1)
2 : dauer (ST, LT)
6 830
1 2 3 4 5 6 range
A 1097.7
(-1.3)
P 		1288.8
(3)
P 		1038.9
(-2.6)
P 		1098.4
(-1.3)
P 		1020.4
(-3)
P 		1095.3
(-1.3)
P 		268
B 1017.1
(1.5)
P 		984.1
(1.1)
P 		669.1
(-3)
P 		1028.3
(1.7)
P 		970.8
(0.9)
P 		1130.4
(3)
P 		461
C 1309.4
(1)
P 		916.4
(-3)
P 		1410.2
(2.1)
P 		1081
(-1.3)
P 		1499.3
(3)
P 		1141
(-0.7)
P 		583
avr 1141.4
(1.9) 		1063.1
(-1.9) 		1039.4
(-3) 		1069.2
(-1.6) 		1163.5
(3) 		1122.2
(1) 		124
No Scale
G range Absolute graph Relative graph Expression Table Dauer Comp.
4 403
1 2 3 4 range
A 234.8
(-1.2)
P 		357.5
(1.1)
P 		461.4
(3)
P 		139.4
(-3)
P 		322
B 295.2
(-0)
P 		385.3
(2.6)
P 		399.4
(3)
P 		191.1
(-3)
P 		208
C 261.8
(-1.2)
P 		339.9
(-0)
P 		542.5
(3)
P 		139.6
(-3)
P 		403
avr 263.9
(-0.9) 		360.9
(0.9) 		467.8
(3) 		156.7
(-3) 		311

1 : 1 state (S1, L1)
2 : dauer (ST, LT)
6 323
1 2 3 4 5 6 range
A 202.4
(-3)
P 		458.4
(3)
P 		226.2
(-2.4)
P 		278.6
(-1.2)
P 		307.9
(-0.5)
P 		266.7
(-1.5)
P 		256
B 353.9
(1.4)
P 		327.6
(0.8)
P 		162.5
(-3)
P 		272.4
(-0.5)
P 		394.4
(2.4)
P 		421.5
(3)
P 		259
C 485.3
(3)
P 		279.6
(-1.6)
P 		358.9
(0.2)
P 		217.4
(-3)
P 		485.1
(3)
P 		382
(0.7)
P 		268
avr 347.2
(1) 		355.2
(1.3) 		249.2
(-3) 		256.1
(-2.7) 		395.8
(3) 		356.7
(1.4) 		147
NetAffx Links Cluster Members
Consensus/Exemplar
Group Members
GeneChip Array Information
Probe Set ID 173168_s_at
GeneChip Array C. elegans Genome Array
Organism Common Name Nematode
Probe Design Information
Transcript ID(Array Design) affy.Ce.27072
Sequence Type Exemplar sequence
Representative Public ID AV178135 NCBI
Target Description AV178135_rc /REP_DB=TREMBL Accession /FEA=EST Transcript /REVCOMP /GB=AV178135 /DEF=Caenorhabditis elegans cDNA clone:yk538f10 : 3prime end, single read.
Cluster Evidence This cluster is supported by a EST Transcript.
Annotation Method Description
Annotation Description This probe set was annotated using the Matching Probes based pipeline to a RefSeq identifier using 1 transcript(s).
Annotation Grade This is a grade A annotation.
Annotation Transcript Cluster (# of Matching Probes) NM_073947(11)
Transcript Assignments
Representative
Transcript		 Description Matching Probes Related Probesets by Grade
NM_073947 NCBI Caenorhabditis elegans GUT differentiation defective family member (gut-2) (gut-2) mRNA, complete cds. 11/11 None
SNAP00000037919 ENSEMBL cdna:SNAP chromosome:CEL140:V:13500460:13501314:1 11/11 None
GENEFINDER00000037923 ENSEMBL cdna:GeneFinder chromosome:CEL140:V:13500460:13501314:1 11/11 None
T10G3.6 ENSEMBL cdna:known chromosome:CEL140:V:13500329:13501839:1 gene:T10G3.6 11/11 None
Annotation Notes
There are no noteworthy cross hybridizing mRNAs found for this probe set.
Genomic Alignment of Consensus/Exemplar Sequence
Assembly Wormbase March 2004
Alignment(s)
Position Identity Coverage Cytoband
chrV:13500579-13501346(+) 100.0 100.0
Public Domain and Genome References
Gene Title Yeast hypothetical 11.2 KD protein like
Gene Symbol gut-2
Ensembl T10G3.6
Entrez Gene 179833 Entrez gene
SwissProt P92022 EMBL-EBI
WormBase CE37990 Wormbase
Functional Annotations
Ortholog
ID Title Organism
ATH1-121501:264364_AT small nuclear ribonucleoprotein D, putative / snRNP core SM-like protein, putative / U6 snRNA-associated Sm-like protein, putative at
ATGENOME1:13917_AT small nuclear ribonucleoprotein D, putative / snRNP core SM-like protein, putative / U6 snRNA-associated Sm-like protein, putative at
CANINE:1586495_AT similar to U6 snRNA-associated Sm-like protein LSm2 (SnRNP core Sm-like protein Sm-x5) (G7b protein) cfa
CANINE_2:CFA.10171.1.A1_AT similar to U6 snRNA-associated Sm-like protein LSm2 (SnRNP core Sm-like protein Sm-x5) (G7b protein) cfa
DROSOPHILA_2:1638070_AT dm
DROSGENOME1:148653_AT dm
HG-U133_PLUS_2:209449_AT LSM2 homolog, U6 small nuclear RNA associated (S. cerevisiae) hs
HG-U133A:209449_AT LSM2 homolog, U6 small nuclear RNA associated (S. cerevisiae) hs
HG-FOCUS:209449_AT LSM2 homolog, U6 small nuclear RNA associated (S. cerevisiae) hs
HG-U133A_2:209449_AT LSM2 homolog, U6 small nuclear RNA associated (S. cerevisiae) hs
HU35KSUBA:AA249819_S_AT LSM2 homolog, U6 small nuclear RNA associated (S. cerevisiae) hs
HU35KSUBC:RC_AA142853_I_AT LSM2 homolog, U6 small nuclear RNA associated (S. cerevisiae) hs
U133_X3P:G11225486_3P_AT LSM2 homolog, U6 small nuclear RNA associated (S. cerevisiae) hs
HG-U95AV2:41375_AT LSM2 homolog, U6 small nuclear RNA associated (S. cerevisiae) hs
HG-U133_PLUS_2:244637_AT LSM2 homolog, U6 small nuclear RNA associated (S. cerevisiae) hs
HG-U133B:244637_AT LSM2 homolog, U6 small nuclear RNA associated (S. cerevisiae) hs
HG-U95B:42289_AT LSM2 homolog, U6 small nuclear RNA associated (S. cerevisiae) hs
HU35KSUBC:RC_T94439_F_AT LSM2 homolog, U6 small nuclear RNA associated (S. cerevisiae) hs
HU35KSUBC:RC_T94439_I_AT LSM2 homolog, U6 small nuclear RNA associated (S. cerevisiae) hs
HU35KSUBD:RC_AA302745_AT LSM2 homolog, U6 small nuclear RNA associated (S. cerevisiae) hs
U133_X3P:HS.104518.0.A1_3P_AT LSM2 homolog, U6 small nuclear RNA associated (S. cerevisiae) hs
MOUSE430_2:1451884_A_AT LSM2 homolog, U6 small nuclear RNA associated (S. cerevisiae) mm
MOE430A:1451884_A_AT LSM2 homolog, U6 small nuclear RNA associated (S. cerevisiae) mm
MOUSE430A_2:1451884_A_AT LSM2 homolog, U6 small nuclear RNA associated (S. cerevisiae) mm
MU11KSUBA:U85207_S_AT LSM2 homolog, U6 small nuclear RNA associated (S. cerevisiae) mm
MG-U74AV2:101083_S_AT LSM2 homolog, U6 small nuclear RNA associated (S. cerevisiae) mm
MU19KSUBA:TC14573_S_AT LSM2 homolog, U6 small nuclear RNA associated (S. cerevisiae), mRNA (cDNA clone MGC:13889 IMAGE:3982410) mm
YEAST_2:1774180_AT Lsm (Like Sm) protein; part of heteroheptameric complexes (Lsm2p-7p and either Lsm1p or 8p): cytoplasmic Lsm1p complex involved in mRNA decay; nuclear Lsm8p complex part of U6 snRNP and possibly involved in processing tRNA, snoRNA, and rRNA Sc
Gene Ontology
GO Biological Process (view graph)
ID Description Evidence Links
6397 mRNA processing inferred from electronic annotation QuickGO AmiGO
GO Cellular Component (view graph)
ID Description Evidence Links
5634 nucleus inferred from electronic annotation QuickGO AmiGO
5732 small nucleolar ribonucleoprotein complex inferred from electronic annotation QuickGO AmiGO
30529 ribonucleoprotein complex inferred from electronic annotation QuickGO AmiGO
Protein Similarities
Method ID Description E-Value
blast CAB03328 Hypothetical protein T10G3.6 [Caenorhabditis elegans] ref|NP_506348.2| GUT differentiation defective family member (gut-2) [Caenorhabditis elegans] 3.0E-49
blast CAB03328 Hypothetical protein T10G3.6 [Caenorhabditis elegans] ref|NP_506348.2| GUT differentiation defective family member (gut-2) [Caenorhabditis elegans] 2.0E-43
blast NP_067000 LSM2 homolog, U6 small nuclear RNA associated [Homo sapiens] gb|AAD21818.1| snRNP [Homo sapiens] ref|XP_581859.2| PREDICTED: similar to U6 snRNA-associated Sm-like protein LSm2 (SnRNP core Sm-like protein Sm-x5) (G7b protein) [Bos taurus] emb|CAI18462.1| LSM2 homolog, U6 small nuclear RNA associated (S. cerevisiae) [Homo sapiens] emb|CAI18212.1| LSM2 homolog, U6 small nuclear RNA associated (S. cerevisiae) [Homo sapiens] emb|CAI17733.1| LSM2 homolog, U6 small nuclear RNA associated (S. cerevisiae) [Homo sapiens] gb|AAH09192.1| LSM2 homolog, U6 small nuclear RNA associated [Homo sapiens] ref|XP_532081.2| PREDICTED: similar to U6 snRNA-associated Sm-like protein LSm2 (SnRNP core Sm-like protein Sm-x5) (G7b protein) [Canis familiaris] emb|CAB52190.1| G7b protein [Homo sapiens] gb|AAH14288.1| Lsm2 protein [Mus musculus] dbj|BAE30544.1| unnamed protein product [Mus musculus] emb|CAG46954.1| LSM2 [Homo sapiens] emb|CAG46943.1| LSM2 [Homo sapiens] gb|AAL14458.1| small ribonuclear protein G7b [Mus musculus] gb|AAL14450.1| small ribonuclear protein G7b [Mus musculus] dbj|BAB63302.1| small nuclear ribonuclear protein D homolog [Homo sapiens] gb|AAG49438.1| snRNP core SM-like protein SM-x5 [Homo sapiens] gb|AAG33023.1| SMX5-like protein [Homo sapiens] gb|AAD56226.1| U6 snRNA-associated Sm-like protein LSm2 [Homo sapiens] sp|Q9Y333|LSM2_HUMAN U6 snRNA-associated Sm-like protein LSm2 (SnRNP core Sm-like protein Sm-x5) (G7b protein) (Small nuclear ribonuclear protein D homolog) sp|O35900|LSM2_MOUSE U6 snRNA-associated Sm-like protein LSm2 (SnRNP core Sm-like protein Sm-x5) (G7b protein) gb|AAB72037.1| snRNP core Sm protein homolog Sm-X5 [Mus musculus] 2.0E-40
blast NP_001016402 LSM2 homolog, U6 small nuclear RNA associated [Xenopus tropicalis] gb|AAH90606.1| Hypothetical protein LOC549156 [Xenopus tropicalis] gb|AAH94397.1| Unknown (protein for MGC:84990) [Xenopus laevis] 3.0E-40
blast NP_085100 snRNP core protein SMX5 [Mus musculus] gb|AAC84171.1| smRNP [Mus musculus] gb|AAC84150.1| smRNP [Mus musculus] gb|AAH49543.1| SnRNP core protein SMX5 [Mus musculus] gb|AAL14457.1| G7b alternative form [Mus musculus] gb|AAL14449.1| G7b alternative form [Mus musculus] gb|AAG31429.1| snRNP core protein SMX5 [Mus musculus] gb|AAG31428.1| snRNP core protein SMX5 [Mus musculus] gb|AAG31427.1| snRNP core protein SMX5 [Mus musculus] gb|AAG31426.1| snRNP core protein SMX5 [Mus musculus] gb|AAG31425.1| snRNP core protein SMX5 [Mus musculus] gb|AAG31424.1| snRNP core protein SMX5 [Mus musculus] gb|AAG31423.1| snRNP core protein SMX5 [Mus musculus] gb|AAB72038.1| snRNP core Sm protein homolog Sm-X5 [Mus musculus] 4.0E-35
blast NP_067000 LSM2 homolog, U6 small nuclear RNA associated [Homo sapiens] gb|AAD21818.1| snRNP [Homo sapiens] ref|XP_581859.2| PREDICTED: similar to U6 snRNA-associated Sm-like protein LSm2 (SnRNP core Sm-like protein Sm-x5) (G7b protein) [Bos taurus] emb|CAI18462.1| LSM2 homolog, U6 small nuclear RNA associated (S. cerevisiae) [Homo sapiens] emb|CAI18212.1| LSM2 homolog, U6 small nuclear RNA associated (S. cerevisiae) [Homo sapiens] emb|CAI17733.1| LSM2 homolog, U6 small nuclear RNA associated (S. cerevisiae) [Homo sapiens] gb|AAH09192.1| LSM2 homolog, U6 small nuclear RNA associated [Homo sapiens] ref|XP_532081.2| PREDICTED: similar to U6 snRNA-associated Sm-like protein LSm2 (SnRNP core Sm-like protein Sm-x5) (G7b protein) [Canis familiaris] emb|CAB52190.1| G7b protein [Homo sapiens] gb|AAH14288.1| Lsm2 protein [Mus musculus] dbj|BAE30544.1| unnamed protein product [Mus musculus] emb|CAG46954.1| LSM2 [Homo sapiens] emb|CAG46943.1| LSM2 [Homo sapiens] gb|AAL14458.1| small ribonuclear protein G7b [Mus musculus] gb|AAL14450.1| small ribonuclear protein G7b [Mus musculus] dbj|BAB63302.1| small nuclear ribonuclear protein D homolog [Homo sapiens] gb|AAG49438.1| snRNP core SM-like protein SM-x5 [Homo sapiens] gb|AAG33023.1| SMX5-like protein [Homo sapiens] gb|AAD56226.1| U6 snRNA-associated Sm-like protein LSm2 [Homo sapiens] sp|Q9Y333|LSM2_HUMAN U6 snRNA-associated Sm-like protein LSm2 (SnRNP core Sm-like protein Sm-x5) (G7b protein) (Small nuclear ribonuclear protein D homolog) sp|O35900|LSM2_MOUSE U6 snRNA-associated Sm-like protein LSm2 (SnRNP core Sm-like protein Sm-x5) (G7b protein) gb|AAB72037.1| snRNP core Sm protein homolog Sm-X5 [Mus musculus] 4.0E-35
Protein Domains
Database ID Description E-Value
Pfam IPR001163 EMBL-EBI Small nuclear ribonucleoprotein (Sm protein) 1.4E-17
Pfam IPR001163 EMBL-EBI Small nuclear ribonucleoprotein (Sm protein) 1.4E-17
Sequence
Target Sequence 
>C. ELEGANS:173168_S_AT
gaaaggacgttgtcgtggagctcaaaaatgatttgagtatctgcggaactctgcactcgg
tcgatcagtatctcaacatgaagttgaccgatatcaccgtctccgatccagaacgatttc
cacatatggtctctgtcaaaaactgcttcatccgcggatccgtcgtcaggtacgtgcaac
tcccatccgatcaagtcgacacacaactcttggctgactcctgccggaaggagcttctcg
attcaaaggc

BLASTn GenBank NR
Probe Info
Probe Sequence(5'-3') Probe X Probe Y Probe Interrogation
Position 		Strandedness
GAAAGGACGTTGTCGTGGAGCTCAA 105 361 21 Antisense
TGAGTATCTGCGGAACTCTGCACTC 635 567 54 Antisense
CTCTGCACTCGGTCGATCAGTATCT 384 231 69 Antisense
GAAGTTGACCGATATCACCGTCTCC 121 337 100 Antisense
TCTCCGATCCAGAACGATTTCCACA 315 611 120 Antisense
ACGATTTCCACATATGGTCTCTGTC 102 93 133 Antisense
TCAAAAACTGCTTCATCCGCGGATC 694 629 156 Antisense
TCCCATCCGATCAAGTCGACACACA 474 597 201 Antisense
GTCGACACACAACTCTTGGCTGACT 171 475 215 Antisense
TTGGCTGACTCCTGCCGGAAGGAGC 640 685 230 Antisense
GGAAGGAGCTTCTCGATTCAAAGGC 114 531 246 Antisense
Sequence Source Affymetrix Proprietary Database