|
|
Cluster Members Consensus/Exemplar Group Members |
GeneChip Array Information |
|
173141_s_at |
|
C. elegans Genome Array |
|
Nematode |
Probe Design Information |
|
affy.Ce.26752
|
|
Exemplar sequence
|
|
AV181555 NCBI
|
|
AV181555_rc /REP_DB=TREMBL Accession /FEA=EST Transcript /REVCOMP /GB=AV181555 /DEF=Caenorhabditis elegans cDNA clone:yk621h5 : 3prime end, single read.
|
This cluster is supported by a EST Transcript. |
Annotation Method Description |
|
This probe set was annotated using the Matching Probes based pipeline to a RefSeq identifier using 1 transcript(s). |
|
This is a grade A annotation. |
|
NM_062512(11) |
|
|
|
|
|
NM_062512 NCBI |
Caenorhabditis elegans Y38A8.2 (Peptidase) mRNA, complete cds. |
11/11 |
A |
SNAP00000028505 ENSEMBL |
cdna:SNAP chromosome:CEL140:II:4954658:4955372:-1 |
11/11 |
None |
GENEFINDER00000028510 ENSEMBL |
cdna:GeneFinder chromosome:CEL140:II:4954658:4955372:-1 |
11/11 |
None |
Y38A8.2.2 ENSEMBL |
cdna:known chromosome:CEL140:II:4954485:4955414:-1 gene:Y38A8.2 |
11/11 |
None |
Y38A8.2.1 ENSEMBL |
cdna:known chromosome:CEL140:II:4954485:4955412:-1 gene:Y38A8.2 |
11/11 |
None | |
There are no noteworthy cross hybridizing mRNAs found for this probe set. | |
Genomic Alignment of Consensus/Exemplar Sequence |
|
Wormbase March 2004 |
|
|
|
|
|
chrII:4954653-4954897(-) |
81.25 |
81.25 |
| |
Public Domain and Genome References |
|
Peptidase
|
|
pbs-3
|
|
Y38A8.2
|
|
173858 Entrez gene
|
|
Q23237 EMBL-EBI
|
|
CE07571 Wormbase
|
Functional Annotations |
|
|
|
|
ATH1-121501:259712_AT |
20S proteasome beta subunit C (PBC2) |
at |
CANINE:1583481_AT |
similar to Proteasome subunit beta type 3 (Proteasome theta chain) (Proteasome chain 13) (Proteasome component C10-II) |
cfa |
CANINE_2:CFA.11683.1.A1_S_AT |
similar to Proteasome subunit beta type 3 (Proteasome theta chain) (Proteasome chain 13) (Proteasome component C10-II) |
cfa |
CANINE_2:CFA.12625.1.A1_S_AT |
similar to Proteasome subunit beta type 3 (Proteasome theta chain) (Proteasome chain 13) (Proteasome component C10-II) |
cfa |
CANINE_2:CFA.12625.1.A1_X_AT |
similar to Proteasome subunit beta type 3 (Proteasome theta chain) (Proteasome chain 13) (Proteasome component C10-II) |
cfa |
DROSOPHILA_2:1623021_AT |
|
dm |
DROSGENOME1:153880_AT |
|
dm |
CHICKEN:GGA.1459.1.S1_AT |
proteasome (prosome, macropain) subunit, beta type, 3 |
gga |
HG-U133A_2:201400_AT |
proteasome (prosome, macropain) subunit, beta type, 3 |
hs |
HG-U133_PLUS_2:201400_AT |
proteasome (prosome, macropain) subunit, beta type, 3 |
hs |
HG-U133A:201400_AT |
proteasome (prosome, macropain) subunit, beta type, 3 |
hs |
HG-FOCUS:201400_AT |
proteasome (prosome, macropain) subunit, beta type, 3 |
hs |
HG-U95AV2:1309_AT |
proteasome (prosome, macropain) subunit, beta type, 3 |
hs |
HC-G110:1309_AT |
proteasome (prosome, macropain) subunit, beta type, 3 |
hs |
HUGENEFL:D26598_AT |
proteasome (prosome, macropain) subunit, beta type, 3 |
hs |
U133_X3P:G4506196_3P_AT |
proteasome (prosome, macropain) subunit, beta type, 3 |
hs |
MU11KSUBA:C76949_RC_S_AT |
proteasome (prosome, macropain) subunit, beta type 3 |
mm |
MU11KSUBA:AA407689_RC_S_AT |
proteasome (prosome, macropain) subunit, beta type 3 |
mm |
MG-U74AV2:94025_AT |
proteasome (prosome, macropain) subunit, beta type 3 |
mm |
MG-U74CV2:171521_AT |
proteasome (prosome, macropain) subunit, beta type 3 |
mm |
MOE430A:1417052_AT |
proteasome (prosome, macropain) subunit, beta type 3 |
mm |
MOUSE430A_2:1417052_AT |
proteasome (prosome, macropain) subunit, beta type 3 |
mm |
MOUSE430_2:1417052_AT |
proteasome (prosome, macropain) subunit, beta type 3 |
mm |
MOE430A:1460198_A_AT |
proteasome (prosome, macropain) subunit, beta type 3 |
mm |
MOUSE430A_2:1460198_A_AT |
proteasome (prosome, macropain) subunit, beta type 3 |
mm |
MOUSE430_2:1460198_A_AT |
proteasome (prosome, macropain) subunit, beta type 3 |
mm |
RG-U34A:D21800_AT |
proteasome (prosome, macropain) subunit, beta type 3 |
rn |
RG-U34A:D21800_G_AT |
proteasome (prosome, macropain) subunit, beta type 3 |
rn |
RG-U34C:RC_AI235296_AT |
proteasome (prosome, macropain) subunit, beta type 3 |
rn |
RAE230A:1398853_AT |
proteasome (prosome, macropain) subunit, beta type 3 |
rn |
RAT230_2:1398853_AT |
proteasome (prosome, macropain) subunit, beta type 3 |
rn | |
|
|
|
|
|
6511 |
ubiquitin-dependent protein catabolism |
inferred from electronic annotation |
QuickGO AmiGO |
|
|
|
|
5839 |
proteasome core complex (sensu Eukaryota) |
inferred from electronic annotation |
QuickGO AmiGO |
|
|
|
|
4175 |
endopeptidase activity |
inferred from electronic annotation |
QuickGO AmiGO | |
|
|
|
|
|
blast |
AAA98018 |
Proteasome beta subunit protein 3 [Caenorhabditis elegans] ref|NP_494913.1| Y38A8.2 [Caenorhabditis elegans] sp|Q23237|PSB3_CAEEL Proteasome subunit beta type 3 (Proteasome subunit beta 3) |
1.0E-114 |
blast |
CAE59013 |
Hypothetical protein CBG02289 [Caenorhabditis briggsae] |
1.0E-113 | |
|
|
|
|
|
Pfam |
IPR001353 EMBL-EBI |
Peptidase T1, 20S proteasome |
9.8E-58 | |
Sequence |
|
>C. ELEGANS:173141_S_AT
ttctggcgcgagaacatgaagccggatgagctcttcgaggctactgctcagtcgattctt
tcttgcttggagcgtgatgctgcatcaggttggggagcagtcgtgtacacaatcactaag
gataaggttaacgtctcaactatcaaggctcgtatgg
BLASTn GenBank NR |
|
|
|
|
|
|
TTCTGGCGCGAGAACATGAAGCCGG |
426 |
693 |
44 |
Antisense |
GAAGCCGGATGAGCTCTTCGAGGCT |
264 |
345 |
61 |
Antisense |
GATGAGCTCTTCGAGGCTACTGCTC |
683 |
411 |
68 |
Antisense |
TCGAGGCTACTGCTCAGTCGATTCT |
282 |
603 |
78 |
Antisense |
TCAGTCGATTCTTTCTTGCTTGGAG |
430 |
623 |
91 |
Antisense |
CTTGCTTGGAGCGTGATGCTGCATC |
244 |
219 |
105 |
Antisense |
GTGATGCTGCATCAGGTTGGGGAGC |
651 |
483 |
117 |
Antisense |
AGGTTGGGGAGCAGTCGTGTACACA |
134 |
55 |
130 |
Antisense |
GCAGTCGTGTACACAATCACTAAGG |
50 |
313 |
140 |
Antisense |
AGGATAAGGTTAACGTCTCAACTAT |
471 |
57 |
162 |
Antisense |
GTCTCAACTATCAAGGCTCGTATGG |
65 |
469 |
176 |
Antisense | |
|
Affymetrix Proprietary Database | |