|
|
Cluster Members Consensus/Exemplar Group Members |
GeneChip Array Information |
|
173125_s_at |
|
C. elegans Genome Array |
|
Nematode |
Probe Design Information |
|
affy.Ce.26746
|
|
Exemplar sequence
|
|
AV181528 NCBI
|
|
AV181528_rc /REP_DB=TREMBL Accession /FEA=EST Transcript /REVCOMP /GB=AV181528 /DEF=Caenorhabditis elegans cDNA clone:yk621e6 : 3prime end, single read.
|
This cluster is supported by a EST Transcript. |
Annotation Method Description |
|
This probe set was annotated using the Matching Probes based pipeline to a RefSeq identifier using 1 transcript(s). |
|
This is a grade A annotation. |
|
NM_001026097(11), NM_068497(11), NM_001026096(11), NM_068500(11) |
|
|
|
|
|
NM_001026097 NCBI |
Caenorhabditis elegans UNCoordinated family member (unc-44) (unc-44) mRNA, complete cds. |
11/11 |
None |
NM_068497 NCBI |
Caenorhabditis elegans UNCoordinated family member (unc-44) (unc-44) mRNA, complete cds. |
11/11 |
None |
NM_001026096 NCBI |
Caenorhabditis elegans UNCoordinated family member (unc-44) (unc-44) mRNA, complete cds. |
11/11 |
None |
NM_068500 NCBI |
Caenorhabditis elegans UNCoordinated family member (unc-44) (unc-44) mRNA, complete cds. |
11/11 |
None |
SNAP00000023739 ENSEMBL |
cdna:SNAP chromosome:CEL140:IV:5981117:5985165:1 |
11/11 |
None |
GENEFINDER00000023990 ENSEMBL |
cdna:GeneFinder chromosome:CEL140:IV:5975560:5985165:1 |
11/11 |
None |
B0350.2c ENSEMBL |
cdna:known chromosome:CEL140:IV:5975560:5987438:1 gene:B0350.2 |
11/11 |
A |
B0350.2f ENSEMBL |
cdna:known chromosome:CEL140:IV:5975560:6004843:1 gene:B0350.2 |
11/11 |
None |
B0350.2d.1 ENSEMBL |
cdna:known chromosome:CEL140:IV:5979302:5985358:1 gene:B0350.2 |
11/11 |
None |
B0350.2b.2 ENSEMBL |
cdna:known chromosome:CEL140:IV:5981051:5985366:1 gene:B0350.2 |
11/11 |
None |
B0350.2b.1 ENSEMBL |
cdna:known chromosome:CEL140:IV:5981054:5985366:1 gene:B0350.2 |
11/11 |
None |
B0350.2d.2 ENSEMBL |
cdna:known chromosome:CEL140:IV:5982419:5985165:1 gene:B0350.2 |
11/11 |
None | |
NM_171907 |
4/11 |
Cross Hyb Matching Probes |
None |
B0350.2e |
4/11 |
Cross Hyb Matching Probes |
None | |
177366 |
7 |
4 |
NM_001026095 |
175561_s_at (11), 176663_s_at (11) |
|
|
|
NM_001026096 |
172153_x_at (11), 173125_s_at (11) |
|
|
|
NM_001026097 |
171738_x_at (9), 172123_x_at (11), 172153_x_at (11), 173125_s_at (11), 174033_at (11), 181045_at (11) |
|
|
|
NM_068497 |
171738_x_at (9), 172123_x_at (11), 172153_x_at (11), 173125_s_at (11) |
|
|
|
NM_068500 |
172153_x_at (11), 173125_s_at (11) | |
Genomic Alignment of Consensus/Exemplar Sequence |
|
Wormbase March 2004 |
|
|
|
|
|
chrIV:5984905-5985184(+) |
69.58 |
69.58 |
| |
Public Domain and Genome References |
|
B0350.2
|
Functional Annotations |
|
|
|
|
|
blast |
AAA93447 |
Uncoordinated protein 44, isoform f [Caenorhabditis elegans] ref|NP_001021268.1| UNCoordinated family member (unc-44) [Caenorhabditis elegans] |
0.0 |
blast |
AAB41827 |
AO13 ankyrin [Caenorhabditis elegans] |
0.0 |
blast |
AAA93444 |
Uncoordinated protein 44, isoform c [Caenorhabditis elegans] ref|NP_500898.1| UNCoordinated family member (unc-44) [Caenorhabditis elegans] gb|AAB41828.1| AO66 ankyrin [Caenorhabditis elegans] |
0.0 |
blast |
AAV34805 |
Uncoordinated protein 44, isoform b [Caenorhabditis elegans] ref|NP_500901.2| UNCoordinated family member (unc-44) [Caenorhabditis elegans] |
0.0 |
blast |
AAV34806 |
Uncoordinated protein 44, isoform d [Caenorhabditis elegans] ref|NP_001021267.1| UNCoordinated family member (unc-44) [Caenorhabditis elegans] |
0.0 |
blast |
AAB41826 |
AO49 ankyrin [Caenorhabditis elegans] |
0.0 | |
|
|
Sequence |
|
>C. ELEGANS:173125_S_AT
ggaaagccatcgtgaagatgatggaacaattgtcacgacgacagtaaccactagtcacat
cagcgaatctccatcgggatcacctacaagacgatcagtggagcccgaagagcatcgtca
tagtcaacatgaagatcacgaag
BLASTn GenBank NR |
|
|
|
|
|
|
GGAAAGCCATCGTGAAGATGATGGA |
459 |
527 |
13 |
Antisense |
GATGATGGAACAATTGTCACGACGA |
502 |
411 |
29 |
Antisense |
GTCACGACGACAGTAACCACTAGTC |
631 |
457 |
44 |
Antisense |
ACAGTAACCACTAGTCACATCAGCG |
590 |
107 |
53 |
Antisense |
TCTCCATCGGGATCACCTACAAGAC |
608 |
607 |
80 |
Antisense |
ATCGGGATCACCTACAAGACGATCA |
395 |
35 |
85 |
Antisense |
ACCTACAAGACGATCAGTGGAGCCC |
435 |
87 |
94 |
Antisense |
GACGATCAGTGGAGCCCGAAGAGCA |
710 |
373 |
102 |
Antisense |
AGTGGAGCCCGAAGAGCATCGTCAT |
356 |
59 |
109 |
Antisense |
AGAGCATCGTCATAGTCAACATGAA |
354 |
69 |
121 |
Antisense |
CATAGTCAACATGAAGATCACGAAG |
432 |
211 |
131 |
Antisense | |
|
Affymetrix Proprietary Database |