|
|
Cluster Members Consensus/Exemplar Group Members |
GeneChip Array Information |
|
173034_s_at |
|
C. elegans Genome Array |
|
Nematode |
Probe Design Information |
|
affy.Ce.27082
|
|
Exemplar sequence
|
|
CEC061 NCBI
|
|
CEC061_rc /REP_DB=TREMBL Accession /FEA=EST Transcript /REVCOMP /GB=C08061 /DEF=C.elegans cDNA clone yk174a6 : 3prime end, single read.
|
This cluster is supported by a EST Transcript. |
Annotation Method Description |
|
This probe set was annotated using the Matching Probes based pipeline to a RefSeq identifier using 1 transcript(s). |
|
This is a grade A annotation. |
|
NM_072157(11) |
|
|
|
|
|
NM_072157 NCBI |
Caenorhabditis elegans F29G9.5 (ATPase) mRNA, complete cds. |
11/11 |
A |
SNAP00000000271 ENSEMBL |
cdna:SNAP chromosome:CEL140:V:6018794:6020262:-1 |
11/11 |
None |
GENEFINDER00000000285 ENSEMBL |
cdna:GeneFinder chromosome:CEL140:V:6018794:6020262:-1 |
11/11 |
None |
F29G9.5.1 ENSEMBL |
cdna:known chromosome:CEL140:V:6018669:6020263:-1 gene:F29G9.5 |
11/11 |
None |
F29G9.5.2 ENSEMBL |
cdna:known chromosome:CEL140:V:6018681:6020265:-1 gene:F29G9.5 |
11/11 |
None | |
There are no noteworthy cross hybridizing mRNAs found for this probe set. | |
Genomic Alignment of Consensus/Exemplar Sequence |
|
Wormbase March 2004 |
|
|
|
|
|
chrV:6018810-6019020(-) |
70.0 |
70.0 |
| |
Public Domain and Genome References |
|
ATPase
|
|
rpt-2
|
|
F29G9.5
|
|
178988 Entrez gene
|
|
O16368 EMBL-EBI
|
|
CE09799 Wormbase
|
Functional Annotations |
|
|
|
|
ATGENOME1:13606_AT |
26S protease regulatory complex subunit 4, putative |
at |
ATH1-121501:265595_AT |
26S protease regulatory complex subunit 4, putative |
at |
CANINE:1586075_S_AT |
similar to peptidase (prosome, macropain) 26S subunit, ATPase 1 |
cfa |
CANINE:1598389_AT |
similar to peptidase (prosome, macropain) 26S subunit, ATPase 1 |
cfa |
CANINE:1596843_X_AT |
similar to peptidase (prosome, macropain) 26S subunit, ATPase 1 |
cfa |
CANINE:1586696_X_AT |
similar to peptidase (prosome, macropain) 26S subunit, ATPase 1 |
cfa |
CANINE_2:CFA.6705.1.A1_S_AT |
similar to peptidase (prosome, macropain) 26S subunit, ATPase 1 |
cfa |
CANINE_2:CFA.868.1.S1_S_AT |
similar to peptidase (prosome, macropain) 26S subunit, ATPase 1 |
cfa |
CANINE_2:CFAAFFX.26768.1.S1_AT |
similar to peptidase (prosome, macropain) 26S subunit, ATPase 1 |
cfa |
DROSOPHILA_2:1630788_AT |
Proteasome 26S subunit subunit 4 ATPase |
dm |
DROSGENOME1:142982_AT |
Proteasome 26S subunit subunit 4 ATPase |
dm |
CHICKEN:GGA.1071.1.S1_AT |
proteasome (prosome, macropain) 26S subunit, ATPase, 1 |
gga |
HG-U95AV2:688_AT |
proteasome (prosome, macropain) 26S subunit, ATPase, 1 |
hs |
HC-G110:688_AT |
proteasome (prosome, macropain) 26S subunit, ATPase, 1 |
hs |
HG-U133_PLUS_2:204219_S_AT |
proteasome (prosome, macropain) 26S subunit, ATPase, 1 |
hs |
HG-U133A:204219_S_AT |
proteasome (prosome, macropain) 26S subunit, ATPase, 1 |
hs |
HG-FOCUS:204219_S_AT |
proteasome (prosome, macropain) 26S subunit, ATPase, 1 |
hs |
HG-U133A_2:204219_S_AT |
proteasome (prosome, macropain) 26S subunit, ATPase, 1 |
hs |
HUGENEFL:L02426_AT |
proteasome (prosome, macropain) 26S subunit, ATPase, 1 |
hs |
U133_X3P:G4506206_3P_S_AT |
proteasome (prosome, macropain) 26S subunit, ATPase, 1 |
hs |
U133_X3P:G4506206_3P_A_AT |
proteasome (prosome, macropain) 26S subunit, ATPase, 1 |
hs |
U133_X3P:204219_3P_S_AT |
proteasome (prosome, macropain) 26S subunit, ATPase, 1 |
hs |
HU35KSUBA:AA348686_AT |
Proteasome (prosome, macropain) 26S subunit, ATPase, 1 |
hs |
MU11KSUBA:U39302_S_AT |
protease (prosome, macropain) 26S subunit, ATPase 1 |
mm |
MU11KSUBB:MSA.33585.0_F_AT |
protease (prosome, macropain) 26S subunit, ATPase 1 |
mm |
MG-U74AV2:160152_AT |
protease (prosome, macropain) 26S subunit, ATPase 1 |
mm |
MOE430A:1439392_X_AT |
protease (prosome, macropain) 26S subunit, ATPase 1 |
mm |
MOUSE430A_2:1439392_X_AT |
protease (prosome, macropain) 26S subunit, ATPase 1 |
mm |
MOUSE430_2:1439392_X_AT |
protease (prosome, macropain) 26S subunit, ATPase 1 |
mm |
MOE430A:1416005_AT |
protease (prosome, macropain) 26S subunit, ATPase 1 |
mm |
MOUSE430A_2:1416005_AT |
protease (prosome, macropain) 26S subunit, ATPase 1 |
mm |
MOUSE430_2:1416005_AT |
protease (prosome, macropain) 26S subunit, ATPase 1 |
mm |
MU11KSUBB:MSA.29005.0_S_AT |
Protease (prosome, macropain) 26S subunit, ATPase 1, mRNA (cDNA clone MGC:6597 IMAGE:3486436) |
mm |
MU19KSUBC:TC35203_S_AT |
Protease (prosome, macropain) 26S subunit, ATPase 1, mRNA (cDNA clone MGC:6597 IMAGE:3486436) |
mm |
RG-U34A:D50696_AT |
peptidase (prosome, macropain) 26S subunit, ATPase 1 |
rn |
RAE230A:1398792_AT |
peptidase (prosome, macropain) 26S subunit, ATPase 1 |
rn |
RAT230_2:1398792_AT |
peptidase (prosome, macropain) 26S subunit, ATPase 1 |
rn |
RAE230B:1381035_AT |
Peptidase (prosome, macropain) 26S subunit, ATPase 1 |
rn |
RAT230_2:1381035_AT |
Peptidase (prosome, macropain) 26S subunit, ATPase 1 |
rn |
RG-U34B:RC_AI045861_AT |
Peptidase (prosome, macropain) 26S subunit, ATPase 1 |
rn |
YEAST_2:1773979_AT |
One of six ATPases of the 19S regulatory particle of the 26S proteasome involved in the degradation of ubiquitinated substrates; required for normal peptide hydrolysis by the core 20S particle |
Sc | |
|
|
|
|
|
30163 |
protein catabolism |
inferred from electronic annotation |
QuickGO AmiGO |
|
|
|
|
5634 |
nucleus |
inferred from electronic annotation |
QuickGO AmiGO |
5737 |
cytoplasm |
inferred from electronic annotation |
QuickGO AmiGO |
|
|
|
|
166 |
nucleotide binding |
inferred from electronic annotation |
QuickGO AmiGO |
5524 |
ATP binding |
inferred from electronic annotation |
QuickGO AmiGO |
16787 |
hydrolase activity |
inferred from electronic annotation |
QuickGO AmiGO | |
|
|
|
|
|
blast |
AAB65906 |
Proteasome regulatory particle, atpase-like protein 2 [Caenorhabditis elegans] ref|NP_504558.1| F29G9.5 [Caenorhabditis elegans] sp|O16368|PRS4_CAEEL Probable 26S protease regulatory subunit |
0.0 |
blast |
CAE64528 |
Hypothetical protein CBG09267 [Caenorhabditis briggsae] |
0.0 |
blast |
AAF56205 |
CG5289-PA [Drosophila melanogaster] ref|NP_524469.2| CG5289-PA [Drosophila melanogaster] gb|AAL13988.1| SD02658p [Drosophila melanogaster] sp|P48601|PRS4_DROME 26S protease regulatory subunit 4 (P26s4) |
0.0 | |
|
|
|
|
|
Pfam |
IPR003959 EMBL-EBI |
AAA ATPase, central region |
1.6E-86 | |
Sequence |
|
>C. ELEGANS:173034_S_AT
gatccatacatctcgaatgacactcggcnaagaagttaacctcgaagagttcatcacagc
naaggacgagttgagtggagctgatatcaaggctatgtgcacagaagctggtctcttagc
tcttcgcgagcgtcgtatgcgtgtcacgatggaagatttcc
BLASTn GenBank NR |
|
|
|
|
|
|
GATCCATACATCTCGAATGACACTC |
84 |
417 |
14 |
Antisense |
CCATACATCTCGAATGACACTCGGC |
339 |
271 |
17 |
Antisense |
GTTAACCTCGAAGAGTTCATCACAG |
133 |
445 |
48 |
Antisense |
GGACGAGTTGAGTGGAGCTGATATC |
256 |
523 |
77 |
Antisense |
GAGCTGATATCAAGGCTATGTGCAC |
258 |
387 |
91 |
Antisense |
ATCAAGGCTATGTGCACAGAAGCTG |
187 |
25 |
99 |
Antisense |
CAGAAGCTGGTCTCTTAGCTCTTCG |
383 |
203 |
115 |
Antisense |
TTAGCTCTTCGCGAGCGTCGTATGC |
392 |
681 |
129 |
Antisense |
TCTTCGCGAGCGTCGTATGCGTGTC |
306 |
617 |
134 |
Antisense |
CGAGCGTCGTATGCGTGTCACGATG |
645 |
249 |
140 |
Antisense |
ATGCGTGTCACGATGGAAGATTTCC |
75 |
41 |
150 |
Antisense | |
|
Affymetrix Proprietary Database | |