|
|
Cluster Members Consensus/Exemplar Group Members |
GeneChip Array Information |
|
172931_x_at |
|
C. elegans Genome Array |
|
Nematode |
Probe Design Information |
|
affy.Ce.13070
|
|
Exemplar sequence
|
|
C52E4.3 NCBI
|
|
C52E4.3 /REP_DB=WormBase Gene ID /WP=CE08945 /TR=SW:Q18786 /GB=CAB01413.1 /SUBMIT=HINXTON /CHR=5 /FEA=Sanger Annotation /DEF=small nuclear ribonucleoprotein D2 like
|
This cluster is supported by a Sanger Annotation. |
Annotation Method Description |
|
This probe set was annotated using the Matching Probes based pipeline to a RefSeq identifier using 1 transcript(s). |
|
This is a grade A annotation. |
|
NM_073603(11) |
|
|
|
|
|
NM_073603 NCBI |
Caenorhabditis elegans Small Nuclear Ribonucleoprotein family member (snr-4) (snr-4) mRNA, complete cds. |
11/11 |
None |
SNAP00000019785 ENSEMBL |
cdna:SNAP chromosome:CEL140:V:11981275:11982204:-1 |
9/11 |
None |
GENEFINDER00000019792 ENSEMBL |
cdna:GeneFinder chromosome:CEL140:V:11981275:11982204:-1 |
9/11 |
None |
C52E4.3.2 ENSEMBL |
cdna:known chromosome:CEL140:V:11981104:11982311:-1 gene:C52E4.3 |
11/11 |
None |
C52E4.3.1 ENSEMBL |
cdna:known chromosome:CEL140:V:11981105:11982322:-1 gene:C52E4.3 |
11/11 |
None | |
There are no noteworthy cross hybridizing mRNAs found for this probe set. | |
Genomic Alignment of Consensus/Exemplar Sequence |
|
Wormbase March 2004 |
|
|
|
|
|
chrV:11981274-11982284(-) |
100.0 |
100.0 |
| |
Public Domain and Genome References |
|
small nuclear ribonucleoprotein D2 like
|
|
snr-4
|
|
C52E4.3
|
|
179639 Entrez gene
|
|
Q18786 EMBL-EBI
|
|
CE08945 Wormbase
|
Functional Annotations |
|
|
|
|
ATGENOME1:20614_S_AT |
small nuclear ribonucleoprotein D2, putative / snRNP core protein D2, putative / Sm protein D2, putative |
at |
ATH1-121501:266482_AT |
small nuclear ribonucleoprotein D2, putative / snRNP core protein D2, putative / Sm protein D2, putative |
at |
DROSGENOME1:141883_AT |
|
dm |
DROSOPHILA_2:1635530_AT |
|
dm |
DROSGENOME1:153483_AT |
|
dm |
HG-U95AV2:35270_AT |
small nuclear ribonucleoprotein D2 polypeptide 16.5kDa |
hs |
HG-U133A:200826_AT |
small nuclear ribonucleoprotein D2 polypeptide 16.5kDa |
hs |
HG-U133_PLUS_2:200826_AT |
small nuclear ribonucleoprotein D2 polypeptide 16.5kDa |
hs |
HG-FOCUS:200826_AT |
small nuclear ribonucleoprotein D2 polypeptide 16.5kDa |
hs |
HG-U133A_2:200826_AT |
small nuclear ribonucleoprotein D2 polypeptide 16.5kDa |
hs |
HUGENEFL:U15008_AT |
small nuclear ribonucleoprotein D2 polypeptide 16.5kDa |
hs |
U133_X3P:G7242206_3P_AT |
small nuclear ribonucleoprotein D2 polypeptide 16.5kDa |
hs |
MU11KSUBA:AA271024_S_AT |
small nuclear ribonucleoprotein D2 |
mm |
MG-U74AV2:95049_AT |
small nuclear ribonucleoprotein D2 |
mm |
MOE430A:1452680_AT |
small nuclear ribonucleoprotein D2 |
mm |
MOUSE430A_2:1452680_AT |
small nuclear ribonucleoprotein D2 |
mm |
MOUSE430_2:1452680_AT |
small nuclear ribonucleoprotein D2 |
mm |
RG-U34A:RC_AA800946_F_AT |
small nuclear ribonucleoprotein D2 (predicted) |
rn |
RG-U34B:RC_AI011181_F_AT |
small nuclear ribonucleoprotein D2 (predicted) |
rn |
RG-U34C:RC_AI176294_AT |
small nuclear ribonucleoprotein D2 (predicted) |
rn |
RAE230A:1371341_AT |
small nuclear ribonucleoprotein D2 (predicted) |
rn |
RAT230_2:1371341_AT |
small nuclear ribonucleoprotein D2 (predicted) |
rn |
YEAST_2:1770868_AT |
Core Sm protein Sm D2; part of heteroheptameric complex (with Smb1p, Smd1p, Smd3p, Sme1p, Smx3p, and Smx2p) that is part of the spliceosomal U1, U2, U4, and U5 snRNPs; homolog of human Sm D2 |
Sc | |
|
|
|
|
|
6397 |
mRNA processing |
inferred from electronic annotation |
QuickGO AmiGO |
|
|
|
|
5634 |
nucleus |
inferred from electronic annotation |
QuickGO AmiGO |
5732 |
small nucleolar ribonucleoprotein complex |
inferred from electronic annotation |
QuickGO AmiGO |
30529 |
ribonucleoprotein complex |
inferred from electronic annotation |
QuickGO AmiGO | |
|
|
|
|
|
blast |
CAB01413 |
Hypothetical protein C52E4.3 [Caenorhabditis elegans] ref|NP_506004.1| Small Nuclear Ribonucleoprotein family member (snr-4) [Caenorhabditis elegans] sp|Q18786|SMD2_CAEEL Probable small nuclear ribonucleoprotein Sm D2 (snRNP core protein D2) (Sm-D2) |
3.0E-52 |
blast |
CAE75361 |
Hypothetical protein CBG23345 [Caenorhabditis briggsae] |
2.0E-50 |
blast |
CAB01413 |
Hypothetical protein C52E4.3 [Caenorhabditis elegans] ref|NP_506004.1| Small Nuclear Ribonucleoprotein family member (snr-4) [Caenorhabditis elegans] sp|Q18786|SMD2_CAEEL Probable small nuclear ribonucleoprotein Sm D2 (snRNP core protein D2) (Sm-D2) |
1.0E-46 |
blast |
CAE75361 |
Hypothetical protein CBG23345 [Caenorhabditis briggsae] |
6.0E-45 | |
|
|
|
|
|
Pfam |
IPR001163 EMBL-EBI |
Small nuclear ribonucleoprotein (Sm protein) |
1.5E-18 |
Pfam |
IPR001163 EMBL-EBI |
Small nuclear ribonucleoprotein (Sm protein) |
1.5E-18 | |
Sequence |
|
>C. ELEGANS:172931_X_AT
ccaaaccccgttcagagatgactgctgaagaactcgctgcaaaggaggacgaggaattca
atgtcggaccactctccatcctcaccaactcagtcaaaaacaatcatcaagttctcatca
attgcagaaacaacaagaagcttctcggaagagttaaggcttttgacagacattgcaaca
tggtcctcgaaaatgtgaaggaaatgtggactgaagtgccaaagactggaaagggaaaga
agaaggcaaagtctgtcgccaaagatcgtttcatctcaaaaatgttcctccgcgg
BLASTn GenBank NR |
|
|
|
|
|
|
CCAAACCCCGTTCAGAGATGACTGC |
248 |
269 |
26 |
Antisense |
AGATGACTGCTGAAGAACTCGCTGC |
689 |
67 |
41 |
Antisense |
GAACTCGCTGCAAAGGAGGACGAGG |
218 |
347 |
55 |
Antisense |
GGAATTCAATGTCGGACCACTCTCC |
270 |
533 |
78 |
Antisense |
CATCCTCACCAACTCAGTCAAAAAC |
499 |
209 |
102 |
Antisense |
CAAGTTCTCATCAATTGCAGAAACA |
473 |
183 |
133 |
Antisense |
GAAGCTTCTCGGAAGAGTTAAGGCT |
635 |
341 |
162 |
Antisense |
GTTAAGGCTTTTGACAGACATTGCA |
428 |
439 |
178 |
Antisense |
CAGACATTGCAACATGGTCCTCGAA |
139 |
205 |
192 |
Antisense |
GTCTGTCGCCAAAGATCGTTTCATC |
612 |
471 |
276 |
Antisense |
TCATCTCAAAAATGTTCCTCCGCGG |
217 |
619 |
296 |
Antisense | |
|
Affymetrix Proprietary Database |