|
|
Cluster Members Consensus/Exemplar Group Members |
GeneChip Array Information |
|
172899_x_at |
|
C. elegans Genome Array |
|
Nematode |
Probe Design Information |
|
affy.Ce.3448
|
|
Exemplar sequence
|
|
F08G2.3 NCBI
|
|
F08G2.3 /REP_DB=WormBase Gene ID /WP=CE03253 /TR=Q9TW44 /GB=CAB04057.1 /SUBMIT=HINXTON /CHR=2 /FEA=Sanger Annotation /DEF=Core histones H2A, H2B, H3 and H4
|
This cluster is supported by a Sanger Annotation. |
Annotation Method Description |
|
This probe set was annotated using the Matching Probes based pipeline to a RefSeq identifier using 1 transcript(s). |
|
This is a grade A annotation. |
|
NM_064498(11) |
|
|
|
|
|
NM_064498 NCBI |
Caenorhabditis elegans HIStone family member (his-42) (his-42) mRNA, complete cds. |
11/11 |
None |
SNAP00000034714 ENSEMBL |
cdna:SNAP chromosome:CEL140:II:13828184:13828594:-1 |
11/11 |
None |
GENEFINDER00000034724 ENSEMBL |
cdna:GeneFinder chromosome:CEL140:II:13828184:13828594:-1 |
11/11 |
None |
F08G2.3 ENSEMBL |
cdna:known chromosome:CEL140:II:13828184:13828594:-1 gene:F08G2.3 |
11/11 |
None | |
NM_068803 |
1/11 |
Cross Hyb Matching Probes |
A |
NM_065411 |
1/11 |
Cross Hyb Matching Probes |
A |
NM_064489 |
8/11 |
Cross Hyb Matching Probes |
A |
NM_064493 |
8/11 |
Cross Hyb Matching Probes |
A |
NM_064494 |
8/11 |
Cross Hyb Matching Probes |
A |
SNAP00000009815 |
8/11 |
Cross Hyb Matching Probes |
None |
SNAP00000009819 |
8/11 |
Cross Hyb Matching Probes |
None |
SNAP00000009820 |
8/11 |
Cross Hyb Matching Probes |
None |
GENEFINDER00000009834 |
8/11 |
Cross Hyb Matching Probes |
None |
GENEFINDER00000009837 |
8/11 |
Cross Hyb Matching Probes |
None |
GENEFINDER00000009841 |
8/11 |
Cross Hyb Matching Probes |
None |
GENEFINDER00000016650 |
1/11 |
Cross Hyb Matching Probes |
None |
SNAP00000016641 |
1/11 |
Cross Hyb Matching Probes |
None |
SNAP00000005174 |
1/11 |
Cross Hyb Matching Probes |
None |
GENEFINDER00000005184 |
1/11 |
Cross Hyb Matching Probes |
None |
ZK131.7 |
8/11 |
Cross Hyb Matching Probes |
A |
ZK131.3 |
8/11 |
Cross Hyb Matching Probes |
A |
ZK131.2 |
8/11 |
Cross Hyb Matching Probes |
A |
E03A3.4 |
1/11 |
Cross Hyb Matching Probes |
A |
F55G1.2 |
1/11 |
Cross Hyb Matching Probes |
A | |
Genomic Alignment of Consensus/Exemplar Sequence |
|
Wormbase March 2004 |
|
|
|
|
|
chrII:13823541-13823952(+) |
97.81 |
97.81 |
|
chrII:13820103-13820514(+) |
97.81 |
97.81 |
|
chrIV:11326564-11326975(+) |
91.97 |
91.97 |
|
chrIV:8334292-8334703(+) |
91.97 |
91.97 |
|
chrIV:7488238-7488649(+) |
91.73 |
91.73 |
|
chrII:13828180-13828591(-) |
100.0 |
100.0 |
|
chrII:13824742-13825153(-) |
97.81 |
97.81 |
|
chrIV:11406427-11406838(-) |
92.21 |
92.21 |
|
chrIV:11337829-11338240(-) |
91.97 |
91.97 |
| |
Public Domain and Genome References |
|
Core histones H2A, H2B, H3 and H4
|
|
his-42
|
|
F08G2.3
|
|
184200 Entrez gene
|
|
P08898 EMBL-EBI
|
|
CE03253 Wormbase
|
Functional Annotations |
|
|
|
|
ATH1-121501:257714_AT |
histone H3 |
at |
CANINE_2:CFAAFFX.16507.1.S1_AT |
similar to histone 1, H2ai (predicted) |
cfa |
CANINE_2:CFAAFFX.17046.1.S1_AT |
similar to histone 1, H2ai (predicted) |
cfa |
CANINE_2:CFAAFFX.791.1.S1_S_AT |
similar to histone 1, H2ai (predicted) |
cfa |
CANINE_2:CFAAFFX.945.1.S1_AT |
similar to histone 1, H2ai (predicted) |
cfa |
CANINE_2:CFAAFFX.945.1.S1_S_AT |
similar to histone 1, H2ai (predicted) |
cfa |
HG-U133_PLUS_2:208577_AT |
histone 1, H3c |
hs |
HG-U133A:208577_AT |
histone 1, H3c |
hs |
HG-FOCUS:208577_AT |
histone 1, H3c |
hs |
HG-U133A_2:208577_AT |
histone 1, H3c |
hs |
U133_X3P:G4504284_3P_AT |
histone 1, H3c |
hs | |
|
|
|
|
|
6334 |
nucleosome assembly |
inferred from electronic annotation |
QuickGO AmiGO |
7001 |
chromosome organization and biogenesis (sensu Eukaryota) |
inferred from electronic annotation |
QuickGO AmiGO |
|
|
|
|
786 |
nucleosome |
inferred from electronic annotation |
QuickGO AmiGO |
5634 |
nucleus |
inferred from electronic annotation |
QuickGO AmiGO |
|
|
|
|
3677 |
DNA binding |
inferred from electronic annotation |
QuickGO AmiGO | |
|
|
|
|
|
blast |
CAB05834 |
Hypothetical protein ZK131.7 [Caenorhabditis elegans] emb|CAB05833.1| Hypothetical protein ZK131.3 [Caenorhabditis elegans] emb|CAB05831.1| Hypothetical protein ZK131.2 [Caenorhabditis elegans] emb|CAA97411.1| Hypothetical protein B0035.10 [Caenorhabditis elegans] emb|CAA92733.1| Hypothetical protein F22B3.2 [Caenorhabditis elegans] emb|CAB07653.1| Hypothetical protein T10C6.13 [Caenorhabditis elegans] emb|CAB05209.1| Hypothetical protein F54E12.1 [Caenorhabditis elegans] emb|CAB04057.1| Hypothetical protein F08G2.3 [Caenorhabditis elegans] gb|AAC05102.1| Histone protein 32 [Caenorhabditis elegans] gb|AAK84514.1| Histone protein 49 [Caenorhabditis elegans] gb|AAF98226.1| Histone protein 17 [Caenorhabditis elegans] gb|AAF98231.1| Histone protein 27 [Caenorhabditis elegans] emb|CAA33644.1| Histone protein [Caenorhabditis elegans] gb|AAB00650.1| Histone protein 59 [Caenorhabditis elegans] gb|AAC48033.1| Histone protein 6 [Caenorhabditis elegans] ref|NP_505292.1| HIStone family member (his-27) [Caenorhabditis elegans] ref|NP_505297.1| HIStone family member (his-17) [Caenorhabditis elegans] ref|NP_496890.1| HIStone family member (his-13) [Caenorhabditis elegans] ref|NP_505199.1| HIStone family member (his-6) [Caenorhabditis elegans] ref|NP_501204.1| F55G1.2 [Caenorhabditis elegans] ref|NP_502138.1| HIStone family member (his-55) [Caenorhabditis elegans] ref|NP_502153.1| HIStone family member (his-63) [Caenorhabditis elegans] ref|NP_496899.1| HIStone family member (his-42) [Caenorhabditis elegans] ref|NP_505276.1| HIStone family member (his-49) [Caenorhabditis elegans] ref|NP_502134.1| HIStone family member (his-45) [Caenorhabditis elegans] ref|NP_507033.1| HIStone family member (his-2) [Caenorhabditis elegans] ref|NP_501407.1| HIStone family member (his-32) [Caenorhabditis elegans] ref|NP_496895.1| HIStone family member (his-25) [Caenorhabditis elegans] ref|NP_496894.1| HIStone family member (his-9) [Caenorhabditis elegans] gb|AAG50235.1| histone H3 [Caenorhabditis elegans] pir||HSKW3 histone H3 - Caenorhabditis elegans |
5.0E-70 |
blast |
P08898 |
Histone H3 |
1.0E-69 |
blast |
AAH74969 |
H3/o protein [Homo sapiens] |
2.0E-68 | |
|
|
|
|
|
Pfam |
IPR007125 EMBL-EBI |
Histone core |
1.6E-29 | |
Sequence |
|
>C. ELEGANS:172899_X_AT
tggctcgtactaagcaaaccgcccgtaaatcgaccggaggaaaggctccaagaaagcaat
tggccaccaaggctgcccgtaaatcggctccagcttccggaggtgtcaagaagccacatc
gttatcgtccaggaaccgtcgctctacgtgagatcagacgttaccagaaatccaccgagc
ttctcatccgcagagctccattccagcgtctcgtccgggagatcgcccaggatttcaaga
ccgatcttcgattccagtcttcagctgttatggctcttcaagaggccgccgaggcttacc
tcgttggacttttcgaggataccaacttgtgtgccatccat
BLASTn GenBank NR |
|
|
|
|
|
|
TGGCTCGTACTAAGCAAACCGCCCG |
221 |
539 |
14 |
Antisense |
CCACCAAGGCTGCCCGTAAATCGGC |
305 |
273 |
77 |
Antisense |
CAAGAAGCCACATCGTTATCGTCCA |
334 |
183 |
120 |
Antisense |
AACCGTCGCTCTACGTGAGATCAGA |
269 |
147 |
147 |
Antisense |
CAGACGTTACCAGAAATCCACCGAG |
382 |
201 |
168 |
Antisense |
GGAGATCGCCCAGGATTTCAAGACC |
709 |
517 |
231 |
Antisense |
TCAAGACCGATCTTCGATTCCAGTC |
481 |
629 |
248 |
Antisense |
GATTCCAGTCTTCAGCTGTTATGGC |
29 |
435 |
263 |
Antisense |
TCTTCAAGAGGCCGCCGAGGCTTAC |
72 |
607 |
288 |
Antisense |
GGCTTACCTCGTTGGACTTTTCGAG |
359 |
371 |
306 |
Antisense |
GGATACCAACTTGTGTGCCATCCAT |
174 |
511 |
330 |
Antisense | |
|
Affymetrix Proprietary Database |