[Home] | [Total List]

[172896_x_at] major sperm protein

Description C34F11.6 /REP_DB=WormBase Gene ID /WP=CE04166 /GEN=msp-49 /TR=Q18461 /GB=AAA85759.1 /SUBMIT=ST.LOUIS /CHR=2 /FEA=Sanger Annotation /DEF=major sperm protein
Cluster 6grp_total > 99      4grp_total > 02      6grp_cgc > 79      6grp_cgc_sub > Da      6grp_total_sub > Increase      6grp_rule_based > S6      4grp_rule_based > L4      

Scale
G range Absolute graph Relative graph Expression Table Dauer Comp.
4 283
1 2 3 4 range
A 12.7
(-3)
A 		52.3
(-2.1)
A 		17.7
(-2.9)
A 		283.1
(3)
A 		270
B 17.9
(-3)
A 		23.8
(-0.6)
A 		18.7
(-2.7)
A 		32.6
(3)
A 		15
C 42.2
(-2.5)
A 		17.6
(-3)
A 		21.1
(-2.9)
A 		295.6
(3)
P 		278
avr 24.3
(-2.8) 		31.2
(-2.6) 		19.2
(-3) 		203.8
(3) 		185

1 : 1 state (S1, L1)
2 : dauer (ST, LT)
6 4146
1 2 3 4 5 6 range
A 25.6
(-3)
A 		16.1
(-3)
A 		128.4
(-2.8)
A 		579.9
(-2.1)
P 		2706.2
(1.3)
P 		3763
(3)
P 		3747
B 47.4
(-3)
A 		69.3
(-2.9)
A 		26.6
(-3)
A 		407.2
(-2.3)
A 		3189.8
(3)
P 		3100.8
(2.8)
P 		3163
C 12.7
(-3)
A 		119.8
(-2.8)
A 		36.2
(-3)
A 		405.4
(-2.4)
A 		4158.7
(3)
P 		3535.4
(2.1)
P 		4146
avr 28.6
(-3) 		68.4
(-2.9) 		63.7
(-2.9) 		464.2
(-2.2) 		3351.6
(2.8) 		3466.4
(3) 		3438
No Scale
G range Absolute graph Relative graph Expression Table Dauer Comp.
4 46
1 2 3 4 range
A 4.6
(-3)
A 		11.4
(-1.9)
A 		4.6
(-3)
A 		41.4
(3)
A 		37
B 5.7
(0.2)
A 		5.9
(0.7)
A 		4.3
(-3)
A 		6.9
(3)
A 		3
C 14
(-1.8)
A 		5
(-3)
A 		7.4
(-2.7)
A 		49.8
(3)
P 		45
avr 8.1
(-2.4) 		7.4
(-2.6) 		5.4
(-3) 		32.7
(3) 		27

1 : 1 state (S1, L1)
2 : dauer (ST, LT)
6 1341
1 2 3 4 5 6 range
A 4.7
(-3)
A 		5.7
(-3)
A 		28
(-2.8)
A 		147.1
(-2.1)
P 		816.6
(2.3)
P 		916.2
(3)
P 		912
B 16.5
(-3)
A 		23.1
(-2.9)
A 		6.4
(-3)
A 		107.9
(-2.5)
A 		1296
(3)
P 		1156.3
(2.4)
P 		1290
C 4.7
(-3)
A 		36.6
(-2.9)
A 		9.2
(-3)
A 		81.5
(-2.7)
A 		1345.7
(3)
P 		1183.5
(2.3)
P 		1341
avr 8.6
(-3) 		21.8
(-2.9) 		14.5
(-3) 		112.2
(-2.5) 		1152.8
(3) 		1085.3
(2.6) 		1144
NetAffx Links Cluster Members
Consensus/Exemplar
Group Members
GeneChip Array Information
Probe Set ID 172896_x_at
GeneChip Array C. elegans Genome Array
Organism Common Name Nematode
Probe Design Information
Transcript ID(Array Design) affy.Ce.4546
Sequence Type Exemplar sequence
Representative Public ID C34F11.6 NCBI
Target Description C34F11.6 /REP_DB=WormBase Gene ID /WP=CE04166 /GEN=msp-49 /TR=Q18461 /GB=AAA85759.1 /SUBMIT=ST.LOUIS /CHR=2 /FEA=Sanger Annotation /DEF=major sperm protein
Cluster Evidence This cluster is supported by a Sanger Annotation.
Annotation Method Description
Annotation Description This probe set was annotated using the Matching Probes based pipeline to a RefSeq identifier using 1 transcript(s).
Annotation Grade This is a grade A annotation.
Annotation Transcript Cluster (# of Matching Probes) NM_062569(11)
Transcript Assignments
Representative
Transcript		 Description Matching Probes Related Probesets by Grade
NM_062569 NCBI Caenorhabditis elegans Major Sperm Protein family member (msp-49) (msp-49) mRNA, complete cds. 11/11 None
SNAP00000021327 ENSEMBL cdna:SNAP chromosome:CEL140:II:5194346:5194729:1 11/11 None
GENEFINDER00000021348 ENSEMBL cdna:GeneFinder chromosome:CEL140:II:5194346:5194729:1 11/11 None
C34F11.6 ENSEMBL cdna:known chromosome:CEL140:II:5194346:5194729:1 gene:C34F11.6 11/11 None
Annotation Notes
Cross Hybridizing mRNA Matched Probes Nature of Assignment Related Probesets by Grade
NM_069433 2/11 Cross Hyb Matching Probes A 
NM_062497 2/11 Cross Hyb Matching Probes A 
NM_068370 1/11 Cross Hyb Matching Probes A 
NM_069448 1/11 Cross Hyb Matching Probes A 
NM_068310 1/11 Cross Hyb Matching Probes A 
NM_068312 1/11 Cross Hyb Matching Probes A 
NM_068313 2/11 Cross Hyb Matching Probes A 
NM_069063 1/11 Cross Hyb Matching Probes A 
NM_062548 1/11 Cross Hyb Matching Probes A 
NM_062558 2/11 Cross Hyb Matching Probes A 
NM_062559 1/11 Cross Hyb Matching Probes None
NM_062571 3/11 Cross Hyb Matching Probes A 
NM_062505 1/11 Cross Hyb Matching Probes A 
NM_068359 1/11 Cross Hyb Matching Probes A 
NM_068377 1/11 Cross Hyb Matching Probes A 
NM_068379 2/11 Cross Hyb Matching Probes A 
NM_062490 4/11 Cross Hyb Matching Probes A 
NM_062500 1/11 Cross Hyb Matching Probes A 
NM_062742 1/11 Cross Hyb Matching Probes A 
NM_069339 1/11 Cross Hyb Matching Probes A 
NM_069358 1/11 Cross Hyb Matching Probes A 
NM_069359 1/11 Cross Hyb Matching Probes A 
NM_069361 1/11 Cross Hyb Matching Probes A 
NM_069380 1/11 Cross Hyb Matching Probes A 
NM_062457 2/11 Cross Hyb Matching Probes A 
NM_062464 2/11 Cross Hyb Matching Probes A 
NM_068372 3/11 Cross Hyb Matching Probes A 
SNAP00000000807 2/11 Cross Hyb Matching Probes None
GENEFINDER00000000821 2/11 Cross Hyb Matching Probes None
SNAP00000007649 2/11 Cross Hyb Matching Probes None
GENEFINDER00000007652 2/11 Cross Hyb Matching Probes None
SNAP00000009139 1/11 Cross Hyb Matching Probes None
GENEFINDER00000009155 1/11 Cross Hyb Matching Probes None
SNAP00000016470 2/11 Cross Hyb Matching Probes None
GENEFINDER00000016484 2/11 Cross Hyb Matching Probes None
SNAP00000019951 2/11 Cross Hyb Matching Probes None
GENEFINDER00000019958 2/11 Cross Hyb Matching Probes None
GENEFINDER00000019959 1/11 Cross Hyb Matching Probes None
SNAP00000021329 3/11 Cross Hyb Matching Probes None
GENEFINDER00000021346 3/11 Cross Hyb Matching Probes None
SNAP00000031244 1/11 Cross Hyb Matching Probes None
GENEFINDER00000031253 1/11 Cross Hyb Matching Probes None
SNAP00000034943 1/11 Cross Hyb Matching Probes None
SNAP00000034948 1/11 Cross Hyb Matching Probes None
GENEFINDER00000034961 1/11 Cross Hyb Matching Probes None
GENEFINDER00000034965 1/11 Cross Hyb Matching Probes None
SNAP00000043869 4/11 Cross Hyb Matching Probes None
SNAP00000043876 2/11 Cross Hyb Matching Probes None
GENEFINDER00000043883 4/11 Cross Hyb Matching Probes None
SNAP00000002639 1/11 Cross Hyb Matching Probes None
SNAP00000002641 1/11 Cross Hyb Matching Probes None
GENEFINDER00000002656 1/11 Cross Hyb Matching Probes None
GENEFINDER00000002661 1/11 Cross Hyb Matching Probes None
SNAP00000004243 1/11 Cross Hyb Matching Probes None
SNAP00000004244 1/11 Cross Hyb Matching Probes None
SNAP00000004246 1/11 Cross Hyb Matching Probes None
GENEFINDER00000004263 1/11 Cross Hyb Matching Probes None
GENEFINDER00000004265 1/11 Cross Hyb Matching Probes None
GENEFINDER00000004273 1/11 Cross Hyb Matching Probes None
SNAP00000005864 1/11 Cross Hyb Matching Probes None
GENEFINDER00000005869 1/11 Cross Hyb Matching Probes None
SNAP00000006004 1/11 Cross Hyb Matching Probes None
SNAP00000006006 2/11 Cross Hyb Matching Probes None
SNAP00000006011 1/11 Cross Hyb Matching Probes None
SNAP00000006013 1/11 Cross Hyb Matching Probes None
SNAP00000006015 2/11 Cross Hyb Matching Probes None
GENEFINDER00000006018 1/11 Cross Hyb Matching Probes None
GENEFINDER00000006020 1/11 Cross Hyb Matching Probes None
GENEFINDER00000006021 1/11 Cross Hyb Matching Probes None
GENEFINDER00000006023 2/11 Cross Hyb Matching Probes None
GENEFINDER00000006024 2/11 Cross Hyb Matching Probes None
SNAP00000007231 1/11 Cross Hyb Matching Probes None
GENEFINDER00000007236 1/11 Cross Hyb Matching Probes None
SNAP00000029404 1/11 Cross Hyb Matching Probes None
SNAP00000029405 1/11 Cross Hyb Matching Probes None
GENEFINDER00000029413 1/11 Cross Hyb Matching Probes None
GENEFINDER00000029416 1/11 Cross Hyb Matching Probes None
SNAP00000029847 1/11 Cross Hyb Matching Probes None
GENEFINDER00000029849 1/11 Cross Hyb Matching Probes None
SNAP00000040132 1/11 Cross Hyb Matching Probes None
SNAP00000040134 2/11 Cross Hyb Matching Probes None
GENEFINDER00000040145 2/11 Cross Hyb Matching Probes None
SNAP00000041533 1/11 Cross Hyb Matching Probes None
GENEFINDER00000041543 1/11 Cross Hyb Matching Probes None
SNAP00000043472 1/11 Cross Hyb Matching Probes None
GENEFINDER00000043484 1/11 Cross Hyb Matching Probes None
SNAP00000043994 2/11 Cross Hyb Matching Probes None
GENEFINDER00000044007 1/11 Cross Hyb Matching Probes None
F26G1.7 2/11 Cross Hyb Matching Probes A 
C33F10.9 2/11 Cross Hyb Matching Probes A 
R05F9.3 4/11 Cross Hyb Matching Probes R A 
R05F9.13 2/11 Cross Hyb Matching Probes A 
ZK546.6 1/11 Cross Hyb Matching Probes A 
ZK546.3 1/11 Cross Hyb Matching Probes A 
F59A6.8 3/11 Cross Hyb Matching Probes None
F09C12.7 1/11 Cross Hyb Matching Probes A 
F58A6.8 2/11 Cross Hyb Matching Probes A 
C34F11.4 3/11 Cross Hyb Matching Probes A 
K05F1.7 1/11 Cross Hyb Matching Probes A 
C09B9.6 1/11 Cross Hyb Matching Probes A 
R13H9.2 1/11 Cross Hyb Matching Probes A 
R13H9.4 1/11 Cross Hyb Matching Probes A 
F36H12.7 1/11 Cross Hyb Matching Probes A 
ZK354.5 1/11 Cross Hyb Matching Probes A 
ZK354.4 2/11 Cross Hyb Matching Probes A 
ZK354.10 1/11 Cross Hyb Matching Probes None
ZK354.11 1/11 Cross Hyb Matching Probes A 
ZK354.1 2/11 Cross Hyb Matching Probes A 
Y59H11AM.1 1/11 Cross Hyb Matching Probes A 
T13F2.10 1/11 Cross Hyb Matching Probes A 
W08D2.9 1/11 Cross Hyb Matching Probes None
K07F5.1 1/11 Cross Hyb Matching Probes A 
K07F5.2 1/11 Cross Hyb Matching Probes A 
K07F5.3 1/11 Cross Hyb Matching Probes A 
F32B6.6 1/11 Cross Hyb Matching Probes A 
C04G2.3 1/11 Cross Hyb Matching Probes None
C04G2.4 2/11 Cross Hyb Matching Probes A 
K08F4.8 1/11 Cross Hyb Matching Probes A 
Genomic Alignment of Consensus/Exemplar Sequence
Assembly Wormbase March 2004
Alignment(s)
Position Identity Coverage Cytoband
chrIV:5062573-5062957(+) 92.71 92.71
chrIV:5260583-5260967(+) 92.19 92.19
chrIV:5297956-5308821(+) 93.23 93.23
chrIV:8571425-8571809(+) 91.93 91.93
chrIV:5249434-5249815(+) 91.15 91.15
chrIV:9894608-9894992(+) 91.41 91.41
chrII:5194343-5194727(+) 100.0 100.0
chrII:5199774-5200158(+) 94.79 94.79
chrII:4933009-4933393(+) 92.97 92.97
chrII:4787144-4899172(+) 94.27 94.27
chrII:4939884-4940265(+) 91.93 91.93
chrIV:5055626-5056010(-) 92.97 92.97
chrIV:5294951-5295335(-) 92.97 92.97
chrIV:5064673-5065057(-) 92.71 92.71
chrIV:5312722-5313106(-) 92.19 92.19
chrIV:9766750-9767134(-) 91.67 91.67
chrIV:5241396-5241777(-) 91.15 91.15
chrII:4916162-4916546(-) 93.75 93.75
chrII:4892294-4892678(-) 93.23 93.23
chrII:5156679-5157062(-) 91.93 91.93
Public Domain and Genome References
Gene Title major sperm protein
Gene Symbol msp-49
Ensembl C34F11.6
Entrez Gene 173888 Entrez gene
SwissProt Q18461 EMBL-EBI
WormBase CE04166 Wormbase
Functional Annotations
Gene Ontology
GO Molecular Function (view graph)
ID Description Evidence Links
5198 structural molecule activity inferred from electronic annotation QuickGO AmiGO
Protein Similarities
Method ID Description E-Value
blast AAA85759 Major sperm protein protein 49 [Caenorhabditis elegans] ref|NP_494970.1| Major Sperm Protein family member (msp-49) [Caenorhabditis elegans] sp|Q18461|MSP49_CAEEL Major sperm protein 49 (MSP) 2.0E-71
blast AAA85761 Major sperm protein protein 50 [Caenorhabditis elegans] emb|CAA94282.1| Hypothetical protein K07F5.1 [Caenorhabditis elegans] gb|AAK85493.1| Major sperm protein protein 53 [Caenorhabditis elegans] gb|AAB42254.1| Major sperm protein protein 51 [Caenorhabditis elegans] gb|AAB42255.1| Major sperm protein protein 113 [Caenorhabditis elegans] gb|AAB42253.1| Major sperm protein protein 59 [Caenorhabditis elegans] gb|AAB42256.1| Major sperm protein protein 65 [Caenorhabditis elegans] gb|AAC71087.1| Major sperm protein protein 64 [Caenorhabditis elegans] gb|AAA68711.1| Major sperm protein protein 142 [Caenorhabditis elegans] gb|AAA96204.1| Major sperm protein protein 45 [Caenorhabditis elegans] gb|AAC26926.1| Major sperm protein protein 19 [Caenorhabditis elegans] ref|NP_500773.1| Major Sperm Protein family member (msp-113) [Caenorhabditis elegans] ref|NP_500771.1| Major Sperm Protein family member (msp-51) [Caenorhabditis elegans] ref|NP_501759.1| Major Sperm Protein family member (msp-81) [Caenorhabditis elegans] ref|NP_500780.1| Major Sperm Protein family member (msp-65) [Caenorhabditis elegans] ref|NP_500778.1| Major Sperm Protein family member (msp-59) [Caenorhabditis elegans] ref|NP_500760.1| Major Sperm Protein family member (msp-19) [Caenorhabditis elegans] ref|NP_500714.1| Major Sperm Protein family member (msp-53) [Caenorhabditis elegans] ref|NP_495149.1| Major Sperm Protein family member (msp-64) [Caenorhabditis elegans] ref|NP_495144.1| Major Sperm Protein family member (msp-142) [Caenorhabditis elegans] ref|NP_494972.1| Major Sperm Protein family member (msp-50) [Caenorhabditis elegans] ref|NP_494959.1| Major Sperm Protein family member (msp-45) [Caenorhabditis elegans] ref|NP_494898.1| Major Sperm Protein family member (msp-31) [Caenorhabditis elegans] ref|NP_494865.1| Major Sperm Protein family member (msp-40) [Caenorhabditis elegans] gb|AAK31477.1| Major sperm protein protein 40 [Caenorhabditis elegans] gb|AAA83175.1| Major sperm protein protein 31 [Caenorhabditis elegans] sp|P53017|MSP19_CAEEL Major sperm protein 19/31/40/45/50/51/53/59/61/65/81/113/142 (MSP) 7.0E-71
blast CAB03362 Hypothetical protein T13F2.11 [Caenorhabditis elegans] ref|NP_501742.1| Major Sperm Protein family member (msp-78) [Caenorhabditis elegans] sp|Q94053|MSP78_CAEEL Major sperm protein 78 (MSP) 1.0E-70
Protein Domains
Database ID Description E-Value
Pfam IPR000535 EMBL-EBI Major sperm protein (MSP) domain 4.3E-32
Sequence
Target Sequence 
>C. ELEGANS:172896_X_AT
gttccaccaggagacatccaaacccagccgggtacgaagatcgtctttaatgccccgtac
gacgacaagcacacctaccacatcaaggtgattaactcctcggctcgccgtattggatac
ggtatcaagaccatcaatatgaagagacttggagttgatccaccatgtggagtcctcgac
ccaaaggaagctgtacttctggcagtttcctgtgatgcctttgcattcggacaggaggac
actaacaatgaccgtatcactgttgagtggaccaacaccccggatggagctgccaagcaa
ttccgtc

BLASTn GenBank NR
Probe Info
Probe Sequence(5'-3') Probe X Probe Y Probe Interrogation
Position 		Strandedness
GTTCCACCAGGAGACATCCAAACCC 345 441 25 Antisense
ACCCAGCCGGGTACGAAGATCGTCT 613 89 46 Antisense
TTAATGCCCCGTACGACGACAAGCA 85 671 71 Antisense
TCAAGGTGATTAACTCCTCGGCTCG 603 631 107 Antisense
ACTCCTCGGCTCGCCGTATTGGATA 101 99 119 Antisense
GGAGTCCTCGACCCAAAGGAAGCTG 612 513 193 Antisense
GAAGCTGTACTTCTGGCAGTTTCCT 384 341 211 Antisense
GGCAGTTTCCTGTGATGCCTTTGCA 504 535 225 Antisense
GATGCCTTTGCATTCGGACAGGAGG 631 413 238 Antisense
ACTGTTGAGTGGACCAACACCCCGG 484 97 283 Antisense
GATGGAGCTGCCAAGCAATTCCGTC 556 407 307 Antisense
Sequence Source Affymetrix Proprietary Database