[Home] | [Total List]

[172882_x_at] Major sperm protein

Description F26G1.7 /REP_DB=WormBase Gene ID /WP=CE02699 /GEN=msp-3 /TR=Q19832 /GB=AAK31504.1 /SUBMIT=ST.LOUIS /CHR=2 /FEA=Sanger Annotation /DEF=Major sperm protein
Cluster 6grp_total > 99      4grp_total > 11      6grp_cgc > 79      6grp_cgc_sub > Da      6grp_total_sub > Increase      6grp_rule_based > S6      4grp_rule_based > L4      

Scale
G range Absolute graph Relative graph Expression Table Dauer Comp.
4 278
1 2 3 4 range
A 60.8
(-1.7)
A 		85.1
(-0.8)
A 		26.8
(-3)
A 		188.5
(3)
P 		162
B 110.4
(-0.2)
A 		73.5
(-2)
A 		52.6
(-3)
A 		175.1
(3)
M 		123
C 79.1
(-2.9)
A 		80.7
(-2.9)
A 		75
(-3)
A 		304.9
(3)
P 		230
avr 83.4
(-1.9) 		79.8
(-2) 		51.5
(-3) 		222.8
(3) 		171

1 : 1 state (S1, L1)
2 : dauer (ST, LT)
6 5727
1 2 3 4 5 6 range
A 39.2
(-3)
A 		70.6
(-3)
A 		104.9
(-2.9)
M 		606.5
(-2.4)
P 		3674.8
(0.8)
P 		5765.8
(3)
P 		5727
B 81.5
(-3)
A 		65.6
(-3)
A 		84.1
(-3)
A 		372.3
(-2.6)
P 		4738
(3)
P 		4563.5
(2.8)
P 		4672
C 51.3
(-3)
A 		113.7
(-2.9)
P 		56.7
(-3)
A 		384.2
(-2.6)
P 		5496.4
(3)
P 		5368.1
(2.9)
P 		5445
avr 57.3
(-3) 		83.3
(-3) 		81.9
(-3) 		454.3
(-2.5) 		4636.4
(2.3) 		5232.5
(3) 		5175
No Scale
G range Absolute graph Relative graph Expression Table Dauer Comp.
4 44
1 2 3 4 range
A 22.1
(1.4)
A 		18.5
(0.3)
A 		7
(-3)
A 		27.6
(3)
P 		21
B 35.2
(2.5)
A 		18.2
(-1.6)
A 		12.2
(-3)
A 		37.3
(3)
M 		25
C 26.2
(-2.4)
A 		23.2
(-3)
A 		26.1
(-2.4)
A 		51.4
(3)
P 		28
avr 27.8
(0.2) 		20
(-1.8) 		15.1
(-3) 		38.8
(3) 		24

1 : 1 state (S1, L1)
2 : dauer (ST, LT)
6 1918
1 2 3 4 5 6 range
A 7.2
(-3)
A 		25.1
(-2.9)
A 		22.8
(-2.9)
M 		153.8
(-2.4)
P 		1108.9
(1.7)
P 		1403.8
(3)
P 		1397
B 28.4
(-3)
A 		21.8
(-3)
A 		20.4
(-3)
A 		98.6
(-2.8)
P 		1925
(3)
P 		1701.7
(2.3)
P 		1905
C 19
(-3)
A 		34.7
(-2.9)
P 		14.4
(-3)
A 		77.3
(-2.8)
P 		1778.6
(2.9)
P 		1797
(3)
P 		1783
avr 18.2
(-3) 		27.2
(-3) 		19.2
(-3) 		109.9
(-2.7) 		1604.2
(2.9) 		1634.2
(3) 		1616
NetAffx Links Cluster Members
Consensus/Exemplar
Group Members
GeneChip Array Information
Probe Set ID 172882_x_at
GeneChip Array C. elegans Genome Array
Organism Common Name Nematode
Probe Design Information
Transcript ID(Array Design) affy.Ce.5099
Sequence Type Exemplar sequence
Representative Public ID F26G1.7 NCBI
Target Description F26G1.7 /REP_DB=WormBase Gene ID /WP=CE02699 /GEN=msp-3 /TR=Q19832 /GB=AAK31504.1 /SUBMIT=ST.LOUIS /CHR=2 /FEA=Sanger Annotation /DEF=Major sperm protein
Cluster Evidence This cluster is supported by a Sanger Annotation.
Annotation Method Description
Annotation Description This probe set was annotated using the Matching Probes based pipeline to a RefSeq identifier using 1 transcript(s).
Annotation Grade This is a grade A annotation.
Annotation Transcript Cluster (# of Matching Probes) NM_062457(11)
Transcript Assignments
Representative
Transcript		 Description Matching Probes Related Probesets by Grade
NM_062457 NCBI Caenorhabditis elegans Major Sperm Protein family member (msp-3) (msp-3) mRNA, complete cds. 11/11 None
SNAP00000000807 ENSEMBL cdna:SNAP chromosome:CEL140:II:4785885:4786268:-1 11/11 None
GENEFINDER00000000821 ENSEMBL cdna:GeneFinder chromosome:CEL140:II:4785885:4786268:-1 11/11 None
F26G1.7 ENSEMBL cdna:known chromosome:CEL140:II:4785885:4786268:-1 gene:F26G1.7 11/11 None
Annotation Notes
Cross Hybridizing mRNA Matched Probes Nature of Assignment Related Probesets by Grade
NM_062487 2/11 Cross Hyb Matching Probes A 
NM_069433 1/11 Cross Hyb Matching Probes A 
NM_062497 2/11 Cross Hyb Matching Probes A 
NM_068370 1/11 Cross Hyb Matching Probes A 
NM_069448 1/11 Cross Hyb Matching Probes A 
NM_068310 1/11 Cross Hyb Matching Probes A 
NM_068312 1/11 Cross Hyb Matching Probes A 
NM_068313 1/11 Cross Hyb Matching Probes A 
NM_069063 1/11 Cross Hyb Matching Probes A 
NM_062558 1/11 Cross Hyb Matching Probes A 
NM_062569 3/11 Cross Hyb Matching Probes A 
NM_062571 1/11 Cross Hyb Matching Probes A 
NM_062505 2/11 Cross Hyb Matching Probes A 
NM_068359 1/11 Cross Hyb Matching Probes A 
NM_068377 1/11 Cross Hyb Matching Probes A 
NM_068379 1/11 Cross Hyb Matching Probes A 
NM_062490 4/11 Cross Hyb Matching Probes A 
NM_062500 2/11 Cross Hyb Matching Probes A 
NM_062748 1/11 Cross Hyb Matching Probes A 
NM_069321 1/11 Cross Hyb Matching Probes A 
NM_069339 1/11 Cross Hyb Matching Probes A 
NM_069358 1/11 Cross Hyb Matching Probes A 
NM_069359 2/11 Cross Hyb Matching Probes A 
NM_069361 1/11 Cross Hyb Matching Probes A 
NM_069380 1/11 Cross Hyb Matching Probes A 
NM_062464 5/11 Cross Hyb Matching Probes A 
NM_068372 1/11 Cross Hyb Matching Probes A 
SNAP00000024816 1/11 Cross Hyb Matching Probes None
GENEFINDER00000024829 1/11 Cross Hyb Matching Probes None
SNAP00000000808 3/11 Cross Hyb Matching Probes None
GENEFINDER00000000824 2/11 Cross Hyb Matching Probes None
SNAP00000007649 1/11 Cross Hyb Matching Probes None
GENEFINDER00000007652 1/11 Cross Hyb Matching Probes None
SNAP00000016470 5/11 Cross Hyb Matching Probes None
GENEFINDER00000016484 5/11 Cross Hyb Matching Probes None
SNAP00000019951 1/11 Cross Hyb Matching Probes None
GENEFINDER00000019958 1/11 Cross Hyb Matching Probes None
SNAP00000021327 3/11 Cross Hyb Matching Probes None
SNAP00000021329 1/11 Cross Hyb Matching Probes None
GENEFINDER00000021346 1/11 Cross Hyb Matching Probes None
GENEFINDER00000021348 3/11 Cross Hyb Matching Probes None
SNAP00000034943 2/11 Cross Hyb Matching Probes None
SNAP00000034948 2/11 Cross Hyb Matching Probes None
GENEFINDER00000034961 2/11 Cross Hyb Matching Probes None
GENEFINDER00000034965 2/11 Cross Hyb Matching Probes None
SNAP00000041369 1/11 Cross Hyb Matching Probes None
GENEFINDER00000041398 1/11 Cross Hyb Matching Probes None
SNAP00000043868 2/11 Cross Hyb Matching Probes None
SNAP00000043869 4/11 Cross Hyb Matching Probes None
SNAP00000043876 2/11 Cross Hyb Matching Probes None
GENEFINDER00000043883 4/11 Cross Hyb Matching Probes None
GENEFINDER00000043888 2/11 Cross Hyb Matching Probes None
SNAP00000002639 1/11 Cross Hyb Matching Probes None
SNAP00000002641 1/11 Cross Hyb Matching Probes None
GENEFINDER00000002656 1/11 Cross Hyb Matching Probes None
GENEFINDER00000002661 1/11 Cross Hyb Matching Probes None
SNAP00000004243 1/11 Cross Hyb Matching Probes None
SNAP00000004244 2/11 Cross Hyb Matching Probes None
SNAP00000004246 1/11 Cross Hyb Matching Probes None
GENEFINDER00000004263 1/11 Cross Hyb Matching Probes None
GENEFINDER00000004265 2/11 Cross Hyb Matching Probes None
GENEFINDER00000004273 1/11 Cross Hyb Matching Probes None
SNAP00000005864 1/11 Cross Hyb Matching Probes None
GENEFINDER00000005869 1/11 Cross Hyb Matching Probes None
SNAP00000006004 1/11 Cross Hyb Matching Probes None
SNAP00000006006 1/11 Cross Hyb Matching Probes None
SNAP00000006011 1/11 Cross Hyb Matching Probes None
SNAP00000006013 1/11 Cross Hyb Matching Probes None
SNAP00000006015 1/11 Cross Hyb Matching Probes None
GENEFINDER00000006018 1/11 Cross Hyb Matching Probes None
GENEFINDER00000006020 1/11 Cross Hyb Matching Probes None
GENEFINDER00000006021 1/11 Cross Hyb Matching Probes None
GENEFINDER00000006023 1/11 Cross Hyb Matching Probes None
GENEFINDER00000006024 1/11 Cross Hyb Matching Probes None
SNAP00000007231 1/11 Cross Hyb Matching Probes None
GENEFINDER00000007236 1/11 Cross Hyb Matching Probes None
SNAP00000023386 1/11 Cross Hyb Matching Probes None
GENEFINDER00000023395 1/11 Cross Hyb Matching Probes None
SNAP00000029404 1/11 Cross Hyb Matching Probes None
SNAP00000029405 1/11 Cross Hyb Matching Probes None
GENEFINDER00000029413 1/11 Cross Hyb Matching Probes None
GENEFINDER00000029416 1/11 Cross Hyb Matching Probes None
SNAP00000029847 1/11 Cross Hyb Matching Probes None
GENEFINDER00000029849 1/11 Cross Hyb Matching Probes None
SNAP00000040134 1/11 Cross Hyb Matching Probes None
GENEFINDER00000040145 1/11 Cross Hyb Matching Probes None
SNAP00000041533 1/11 Cross Hyb Matching Probes None
GENEFINDER00000041543 1/11 Cross Hyb Matching Probes None
SNAP00000043472 1/11 Cross Hyb Matching Probes None
GENEFINDER00000043484 1/11 Cross Hyb Matching Probes None
SNAP00000043994 1/11 Cross Hyb Matching Probes None
GENEFINDER00000044007 1/11 Cross Hyb Matching Probes None
F26G1.8 3/11 Cross Hyb Matching Probes None
C33F10.9 5/11 Cross Hyb Matching Probes A 
R05F9.8 2/11 Cross Hyb Matching Probes A 
R05F9.3 4/11 Cross Hyb Matching Probes R A 
R05F9.13 2/11 Cross Hyb Matching Probes A 
ZK546.6 2/11 Cross Hyb Matching Probes A 
ZK546.3 2/11 Cross Hyb Matching Probes A 
F59A6.8 2/11 Cross Hyb Matching Probes None
F58A6.8 1/11 Cross Hyb Matching Probes A 
C34F11.6 3/11 Cross Hyb Matching Probes A 
C34F11.4 1/11 Cross Hyb Matching Probes A 
ZK1248.6 1/11 Cross Hyb Matching Probes A 
C09B9.6 1/11 Cross Hyb Matching Probes A 
R13H9.2 1/11 Cross Hyb Matching Probes A 
R13H9.4 1/11 Cross Hyb Matching Probes A 
F36H12.7 1/11 Cross Hyb Matching Probes A 
ZK354.5 1/11 Cross Hyb Matching Probes A 
ZK354.4 1/11 Cross Hyb Matching Probes A 
ZK354.10 1/11 Cross Hyb Matching Probes None
ZK354.11 1/11 Cross Hyb Matching Probes A 
ZK354.1 1/11 Cross Hyb Matching Probes A 
Y59H11AM.1 1/11 Cross Hyb Matching Probes A 
ZK1251.6 1/11 Cross Hyb Matching Probes A 
T13F2.10 1/11 Cross Hyb Matching Probes A 
W08D2.9 1/11 Cross Hyb Matching Probes None
K07F5.1 1/11 Cross Hyb Matching Probes A 
K07F5.2 2/11 Cross Hyb Matching Probes A 
K07F5.3 1/11 Cross Hyb Matching Probes A 
F32B6.6 1/11 Cross Hyb Matching Probes A 
C04G2.4 1/11 Cross Hyb Matching Probes A 
K08F4.8 1/11 Cross Hyb Matching Probes A 
Genomic Alignment of Consensus/Exemplar Sequence
Assembly Wormbase March 2004
Alignment(s)
Position Identity Coverage Cytoband
chrII:4825399-4825783(+) 95.83 95.83
chrII:4933009-4933393(+) 93.75 93.75
chrII:4939884-4940265(+) 91.93 91.93
chrIV:5260583-5260967(+) 92.45 92.45
chrIV:5297956-5298340(+) 92.45 92.45
chrIV:5316517-5316901(+) 92.45 92.45
chrIV:9894608-9894992(+) 92.45 92.45
chrIV:5062573-5062957(+) 91.93 91.93
chrIV:9770025-9770409(+) 91.67 91.67
chrIV:10093057-10093457(+) 91.93 91.93
chrII:4785883-4786267(-) 100.0 100.0
chrII:4916162-4916546(-) 94.01 94.01
chrII:4892294-4892678(-) 92.71 92.71
chrII:5156679-5157062(-) 91.15 91.15
chrIV:9766750-9767134(-) 92.71 92.71
chrIV:5064673-5065057(-) 92.19 92.19
chrIV:5294951-5295335(-) 92.19 92.19
chrIV:5312722-5313106(-) 92.19 92.19
chrIV:5055626-5056010(-) 91.67 91.67
chrIV:10143333-10143717(-) 91.67 91.67
Public Domain and Genome References
Gene Title Major sperm protein
Gene Symbol msp-3
Ensembl F26G1.7
Entrez Gene 173825 Entrez gene
SwissProt Q19832 EMBL-EBI
WormBase CE02699 Wormbase
Functional Annotations
Gene Ontology
GO Molecular Function (view graph)
ID Description Evidence Links
5198 structural molecule activity inferred from electronic annotation QuickGO AmiGO
Protein Similarities
Method ID Description E-Value
blast AAK31504 Major sperm protein protein 3 [Caenorhabditis elegans] ref|NP_494858.1| Major Sperm Protein family member (msp-3) [Caenorhabditis elegans] sp|Q19832|MSP3_CAEEL Major sperm protein 3 (MSP) 1.0E-71
blast AAA85761 Major sperm protein protein 50 [Caenorhabditis elegans] emb|CAA94282.1| Hypothetical protein K07F5.1 [Caenorhabditis elegans] gb|AAK85493.1| Major sperm protein protein 53 [Caenorhabditis elegans] gb|AAB42254.1| Major sperm protein protein 51 [Caenorhabditis elegans] gb|AAB42255.1| Major sperm protein protein 113 [Caenorhabditis elegans] gb|AAB42253.1| Major sperm protein protein 59 [Caenorhabditis elegans] gb|AAB42256.1| Major sperm protein protein 65 [Caenorhabditis elegans] gb|AAC71087.1| Major sperm protein protein 64 [Caenorhabditis elegans] gb|AAA68711.1| Major sperm protein protein 142 [Caenorhabditis elegans] gb|AAA96204.1| Major sperm protein protein 45 [Caenorhabditis elegans] gb|AAC26926.1| Major sperm protein protein 19 [Caenorhabditis elegans] ref|NP_500773.1| Major Sperm Protein family member (msp-113) [Caenorhabditis elegans] ref|NP_500771.1| Major Sperm Protein family member (msp-51) [Caenorhabditis elegans] ref|NP_501759.1| Major Sperm Protein family member (msp-81) [Caenorhabditis elegans] ref|NP_500780.1| Major Sperm Protein family member (msp-65) [Caenorhabditis elegans] ref|NP_500778.1| Major Sperm Protein family member (msp-59) [Caenorhabditis elegans] ref|NP_500760.1| Major Sperm Protein family member (msp-19) [Caenorhabditis elegans] ref|NP_500714.1| Major Sperm Protein family member (msp-53) [Caenorhabditis elegans] ref|NP_495149.1| Major Sperm Protein family member (msp-64) [Caenorhabditis elegans] ref|NP_495144.1| Major Sperm Protein family member (msp-142) [Caenorhabditis elegans] ref|NP_494972.1| Major Sperm Protein family member (msp-50) [Caenorhabditis elegans] ref|NP_494959.1| Major Sperm Protein family member (msp-45) [Caenorhabditis elegans] ref|NP_494898.1| Major Sperm Protein family member (msp-31) [Caenorhabditis elegans] ref|NP_494865.1| Major Sperm Protein family member (msp-40) [Caenorhabditis elegans] gb|AAK31477.1| Major sperm protein protein 40 [Caenorhabditis elegans] gb|AAA83175.1| Major sperm protein protein 31 [Caenorhabditis elegans] sp|P53017|MSP19_CAEEL Major sperm protein 19/31/40/45/50/51/53/59/61/65/81/113/142 (MSP) 3.0E-71
blast CAB03362 Hypothetical protein T13F2.11 [Caenorhabditis elegans] ref|NP_501742.1| Major Sperm Protein family member (msp-78) [Caenorhabditis elegans] sp|Q94053|MSP78_CAEEL Major sperm protein 78 (MSP) 4.0E-71
Protein Domains
Database ID Description E-Value
Pfam IPR000535 EMBL-EBI Major sperm protein (MSP) domain 1.1E-34
Sequence
Target Sequence 
>C. ELEGANS:172882_X_AT
catccaaacccagccgggtacgaagatcgtcttcaatgcaccatacgacgacaagcacac
ctaccacattaaggtgatcaattcatctgctcgccgtattggatatggaatcaagaccac
caatatgaagagacttggagttgatccaccatgtggagttttggacccaaaggaagctgt
gcttcttgccgtgtcatgcgatgccttcgccttcggacaggaggacactaacaacgatcg
tatcactgttgagtggaccaacaccccggatggagctgccaggcagttccgccgagagtg
gttccaaggag

BLASTn GenBank NR
Probe Info
Probe Sequence(5'-3') Probe X Probe Y Probe Interrogation
Position 		Strandedness
CATCCAAACCCAGCCGGGTACGAAG 23 187 39 Antisense
GAAGATCGTCTTCAATGCACCATAC 125 339 60 Antisense
CACCATACGACGACAAGCACACCTA 647 201 77 Antisense
AAGGTGATCAATTCATCTGCTCGCC 666 159 109 Antisense
TCATCTGCTCGCCGTATTGGATATG 181 621 121 Antisense
AAGGAAGCTGTGCTTCTTGCCGTGT 416 161 208 Antisense
CCTTCGCCTTCGGACAGGAGGACAC 290 269 242 Antisense
GGAGGACACTAACAACGATCGTATC 216 513 258 Antisense
ACTGTTGAGTGGACCAACACCCCGG 480 97 283 Antisense
GATGGAGCTGCCAGGCAGTTCCGCC 554 407 307 Antisense
TTCCGCCGAGAGTGGTTCCAAGGAG 550 695 325 Antisense
Sequence Source Affymetrix Proprietary Database