[Home] | [Total List]

[172853_x_at] major sperm protein

Description C04G2.4 /REP_DB=WormBase Gene ID /WP=CE03853 /GEN=msp-36 /TR=Q27280 /GB=CAA94674.1 /SUBMIT=HINXTON /CHR=4 /FEA=Sanger Annotation /DEF=major sperm protein
Cluster 6grp_total > 98      4grp_total > 03      6grp_cgc > 69      6grp_cgc_sub > Da      6grp_total_sub > Increase      6grp_rule_based > S6      4grp_rule_based > L4      

Scale
G range Absolute graph Relative graph Expression Table Dauer Comp.
4 792
1 2 3 4 range
A 46.7
(-3)
A 		42.3
(-3)
A 		71.3
(-2.7)
A 		593.6
(3)
P 		551
B 127.8
(-0.8)
A 		65
(-1.9)
A 		7.1
(-3)
A 		334.3
(3)
P 		327
C 124.4
(-2.2)
A 		14.1
(-3)
A 		25.5
(-2.9)
A 		798.6
(3)
P 		785
avr 99.6
(-2.3) 		40.5
(-2.9) 		34.6
(-3) 		575.5
(3) 		541

1 : 1 state (S1, L1)
2 : dauer (ST, LT)
6 13639
1 2 3 4 5 6 range
A 19.9
(-3)
A 		40.1
(-3)
A 		240.2
(-2.9)
P 		1230.1
(-2.5)
P 		8720.5
(0.8)
P 		13658.6
(3)
P 		13639
B 68.5
(-3)
A 		120.2
(-3)
A 		103.1
(-3)
A 		945.4
(-2.6)
P 		8767.6
(1.5)
P 		11786.1
(3)
P 		11718
C 21.6
(-3)
A 		214.6
(-2.9)
P 		64.7
(-3)
A 		1003.2
(-2.6)
P 		11527.4
(2.1)
P 		13443.4
(3)
P 		13422
avr 36.7
(-3) 		125
(-3) 		136
(-3) 		1059.6
(-2.5) 		9671.8
(1.5) 		12962.7
(3) 		12926
No Scale
G range Absolute graph Relative graph Expression Table Dauer Comp.
4 133
1 2 3 4 range
A 17
(-2.4)
A 		9.2
(-3)
A 		18.6
(-2.3)
A 		86.9
(3)
P 		78
B 40.7
(0.4)
A 		16
(-1.8)
A 		1.6
(-3)
A 		71.2
(3)
P 		70
C 41.2
(-1.3)
A 		4.1
(-3)
A 		8.9
(-2.8)
A 		134.7
(3)
P 		131
avr 33
(-1.4) 		9.8
(-3) 		9.7
(-3) 		97.6
(3) 		88

1 : 1 state (S1, L1)
2 : dauer (ST, LT)
6 4497
1 2 3 4 5 6 range
A 3.7
(-3)
A 		14.3
(-3)
A 		52.3
(-2.9)
P 		312
(-2.4)
P 		2631.5
(1.7)
P 		3325.4
(3)
P 		3322
B 23.8
(-3)
A 		40
(-3)
A 		25
(-3)
A 		250.4
(-2.7)
P 		3562.2
(1.9)
P 		4395
(3)
P 		4371
C 8
(-3)
A 		65.5
(-2.9)
P 		16.5
(-3)
A 		201.7
(-2.7)
P 		3730.1
(2)
P 		4500.3
(3)
P 		4492
avr 11.8
(-3) 		39.9
(-3) 		31.3
(-3) 		254.7
(-2.6) 		3307.9
(1.9) 		4073.6
(3) 		4062
NetAffx Links Cluster Members
Consensus/Exemplar
Group Members
GeneChip Array Information
Probe Set ID 172853_x_at
GeneChip Array C. elegans Genome Array
Organism Common Name Nematode
Probe Design Information
Transcript ID(Array Design) affy.Ce.9288
Sequence Type Exemplar sequence
Representative Public ID C04G2.4 NCBI
Target Description C04G2.4 /REP_DB=WormBase Gene ID /WP=CE03853 /GEN=msp-36 /TR=Q27280 /GB=CAA94674.1 /SUBMIT=HINXTON /CHR=4 /FEA=Sanger Annotation /DEF=major sperm protein
Cluster Evidence This cluster is supported by a Sanger Annotation.
Annotation Method Description
Annotation Description This probe set was annotated using the Matching Probes based pipeline to a RefSeq identifier using 1 transcript(s).
Annotation Grade This is a grade A annotation.
Annotation Transcript Cluster (# of Matching Probes) NM_069433(11)
Transcript Assignments
Representative
Transcript		 Description Matching Probes Related Probesets by Grade
NM_069433 NCBI Caenorhabditis elegans Major Sperm Protein family member (msp-36) (msp-36) mRNA, complete cds. 11/11 None
SNAP00000040134 ENSEMBL cdna:SNAP chromosome:CEL140:IV:10095405:10095788:1 11/11 None
GENEFINDER00000040145 ENSEMBL cdna:GeneFinder chromosome:CEL140:IV:10095405:10095788:1 11/11 None
C04G2.4 ENSEMBL cdna:known chromosome:CEL140:IV:10095405:10095788:1 gene:C04G2.4 11/11 None
Annotation Notes
Cross Hybridizing mRNA Matched Probes Nature of Assignment Related Probesets by Grade
NM_062497 1/11 Cross Hyb Matching Probes A 
NM_068370 2/11 Cross Hyb Matching Probes A 
NM_069448 4/11 Cross Hyb Matching Probes A 
NM_068310 2/11 Cross Hyb Matching Probes A 
NM_068312 2/11 Cross Hyb Matching Probes A 
NM_068313 1/11 Cross Hyb Matching Probes A 
NM_069063 2/11 Cross Hyb Matching Probes A 
NM_062569 2/11 Cross Hyb Matching Probes A 
NM_062571 2/11 Cross Hyb Matching Probes A 
NM_068351 1/11 Cross Hyb Matching Probes A 
NM_068354 1/11 Cross Hyb Matching Probes A 
NM_068359 1/11 Cross Hyb Matching Probes A 
NM_068377 2/11 Cross Hyb Matching Probes A 
NM_068379 1/11 Cross Hyb Matching Probes A 
NM_062490 1/11 Cross Hyb Matching Probes A 
NM_069321 4/11 Cross Hyb Matching Probes A 
NM_069339 5/11 Cross Hyb Matching Probes A 
NM_069341 4/11 Cross Hyb Matching Probes A 
NM_069358 5/11 Cross Hyb Matching Probes A 
NM_069359 5/11 Cross Hyb Matching Probes A 
NM_069361 5/11 Cross Hyb Matching Probes A 
NM_069380 4/11 Cross Hyb Matching Probes A 
NM_062457 1/11 Cross Hyb Matching Probes A 
NM_062464 1/11 Cross Hyb Matching Probes A 
NM_068372 2/11 Cross Hyb Matching Probes A 
SNAP00000024816 2/11 Cross Hyb Matching Probes None
GENEFINDER00000024829 2/11 Cross Hyb Matching Probes None
SNAP00000000807 1/11 Cross Hyb Matching Probes None
GENEFINDER00000000821 1/11 Cross Hyb Matching Probes None
SNAP00000016470 1/11 Cross Hyb Matching Probes None
GENEFINDER00000016484 1/11 Cross Hyb Matching Probes None
SNAP00000021327 2/11 Cross Hyb Matching Probes None
SNAP00000021329 2/11 Cross Hyb Matching Probes None
GENEFINDER00000021346 2/11 Cross Hyb Matching Probes None
GENEFINDER00000021348 2/11 Cross Hyb Matching Probes None
SNAP00000043869 1/11 Cross Hyb Matching Probes None
SNAP00000043876 1/11 Cross Hyb Matching Probes None
GENEFINDER00000043883 1/11 Cross Hyb Matching Probes None
SNAP00000002639 1/11 Cross Hyb Matching Probes None
SNAP00000002641 1/11 Cross Hyb Matching Probes None
GENEFINDER00000002656 1/11 Cross Hyb Matching Probes None
GENEFINDER00000002661 1/11 Cross Hyb Matching Probes None
SNAP00000004243 5/11 Cross Hyb Matching Probes None
SNAP00000004244 5/11 Cross Hyb Matching Probes None
SNAP00000004246 5/11 Cross Hyb Matching Probes None
GENEFINDER00000004263 5/11 Cross Hyb Matching Probes None
GENEFINDER00000004265 5/11 Cross Hyb Matching Probes None
GENEFINDER00000004273 5/11 Cross Hyb Matching Probes None
SNAP00000005864 4/11 Cross Hyb Matching Probes None
SNAP00000005865 1/11 Cross Hyb Matching Probes None
GENEFINDER00000005869 4/11 Cross Hyb Matching Probes None
SNAP00000006004 2/11 Cross Hyb Matching Probes None
SNAP00000006006 2/11 Cross Hyb Matching Probes None
SNAP00000006011 1/11 Cross Hyb Matching Probes None
SNAP00000006013 2/11 Cross Hyb Matching Probes None
SNAP00000006015 1/11 Cross Hyb Matching Probes None
GENEFINDER00000006018 1/11 Cross Hyb Matching Probes None
GENEFINDER00000006020 2/11 Cross Hyb Matching Probes None
GENEFINDER00000006021 2/11 Cross Hyb Matching Probes None
GENEFINDER00000006023 2/11 Cross Hyb Matching Probes None
GENEFINDER00000006024 1/11 Cross Hyb Matching Probes None
SNAP00000007231 2/11 Cross Hyb Matching Probes None
GENEFINDER00000007236 2/11 Cross Hyb Matching Probes None
SNAP00000023386 4/11 Cross Hyb Matching Probes None
GENEFINDER00000023395 4/11 Cross Hyb Matching Probes None
SNAP00000029404 2/11 Cross Hyb Matching Probes None
SNAP00000029405 1/11 Cross Hyb Matching Probes None
GENEFINDER00000029413 2/11 Cross Hyb Matching Probes None
GENEFINDER00000029416 1/11 Cross Hyb Matching Probes None
SNAP00000029847 2/11 Cross Hyb Matching Probes None
GENEFINDER00000029849 2/11 Cross Hyb Matching Probes None
SNAP00000034129 1/11 Cross Hyb Matching Probes None
SNAP00000034134 1/11 Cross Hyb Matching Probes None
GENEFINDER00000034137 1/11 Cross Hyb Matching Probes None
GENEFINDER00000034140 1/11 Cross Hyb Matching Probes None
SNAP00000040132 5/11 Cross Hyb Matching Probes None
SNAP00000041533 4/11 Cross Hyb Matching Probes None
GENEFINDER00000041543 4/11 Cross Hyb Matching Probes None
SNAP00000043472 5/11 Cross Hyb Matching Probes None
SNAP00000043475 4/11 Cross Hyb Matching Probes None
GENEFINDER00000043484 5/11 Cross Hyb Matching Probes None
GENEFINDER00000043489 4/11 Cross Hyb Matching Probes None
SNAP00000043994 2/11 Cross Hyb Matching Probes None
GENEFINDER00000044007 1/11 Cross Hyb Matching Probes None
F26G1.7 1/11 Cross Hyb Matching Probes A 
C33F10.9 1/11 Cross Hyb Matching Probes A 
R05F9.3 1/11 Cross Hyb Matching Probes R A 
R05F9.13 1/11 Cross Hyb Matching Probes A 
F59A6.8 1/11 Cross Hyb Matching Probes None
C34F11.6 2/11 Cross Hyb Matching Probes A 
C34F11.4 2/11 Cross Hyb Matching Probes A 
C09B9.6 2/11 Cross Hyb Matching Probes A 
R13H9.2 2/11 Cross Hyb Matching Probes A 
R13H9.4 1/11 Cross Hyb Matching Probes A 
Y59E9AR.7 1/11 Cross Hyb Matching Probes A 
Y59E9AR.1 1/11 Cross Hyb Matching Probes A 
F36H12.7 1/11 Cross Hyb Matching Probes A 
ZK354.5 2/11 Cross Hyb Matching Probes A 
ZK354.4 2/11 Cross Hyb Matching Probes A 
ZK354.10 2/11 Cross Hyb Matching Probes None
ZK354.11 2/11 Cross Hyb Matching Probes A 
ZK354.1 1/11 Cross Hyb Matching Probes A 
Y59H11AM.1 2/11 Cross Hyb Matching Probes A 
ZK1251.6 4/11 Cross Hyb Matching Probes A 
T13F2.10 5/11 Cross Hyb Matching Probes A 
T13F2.11 4/11 Cross Hyb Matching Probes A 
W08D2.9 1/11 Cross Hyb Matching Probes None
K07F5.1 5/11 Cross Hyb Matching Probes A 
K07F5.2 5/11 Cross Hyb Matching Probes A 
K07F5.3 5/11 Cross Hyb Matching Probes A 
F32B6.6 4/11 Cross Hyb Matching Probes A 
C04G2.3 6/11 Cross Hyb Matching Probes None
K08F4.8 4/11 Cross Hyb Matching Probes A 
K08F4.10 1/11 Cross Hyb Matching Probes None
Genomic Alignment of Consensus/Exemplar Sequence
Assembly Wormbase March 2004
Alignment(s)
Position Identity Coverage Cytoband
chrIV:10095410-10095794(+) 100.0 100.0
chrIV:9837628-9838012(+) 97.4 97.4
chrIV:9841518-9841902(+) 97.4 97.4
chrIV:9688997-9689381(+) 95.83 95.83
chrIV:10093057-10093457(+) 96.09 96.09
chrIV:9770025-9770409(+) 95.57 95.57
chrIV:9894608-9894992(+) 95.31 95.31
chrIV:5297956-5298340(+) 93.49 93.49
chrIV:5316517-5316901(+) 93.49 93.49
chrIV:5062573-5062957(+) 92.19 92.19
chrIV:8571425-8571809(+) 91.93 91.93
chrIV:10143333-10143717(-) 95.83 95.83
chrIV:9766750-9767134(-) 95.57 95.57
chrIV:9836013-9836397(-) 95.57 95.57
chrIV:5055626-5056010(-) 92.45 92.45
chrIV:5294951-5295335(-) 92.19 92.19
chrIV:5064673-5065057(-) 91.93 91.93
chrIV:5312595-5313106(-) 91.67 91.67
chrII:4916162-4916546(-) 92.19 92.19
chrII:5012683-5013236(-) 91.41 91.41
Public Domain and Genome References
Gene Title major sperm protein
Gene Symbol msp-36
Ensembl C04G2.4
Entrez Gene 177874 Entrez gene
SwissProt P05634 EMBL-EBI
WormBase CE03853 Wormbase
Functional Annotations
Gene Ontology
GO Molecular Function (view graph)
ID Description Evidence Links
5198 structural molecule activity inferred from electronic annotation QuickGO AmiGO
Protein Similarities
Method ID Description E-Value
blast CAA94283 Hypothetical protein K07F5.3 [Caenorhabditis elegans] emb|CAA94278.1| Hypothetical protein K07F5.2 [Caenorhabditis elegans] emb|CAA92502.1| Hypothetical protein ZK1251.6 [Caenorhabditis elegans] emb|CAA94674.1| Hypothetical protein C04G2.4 [Caenorhabditis elegans] ref|NP_501834.1| Major Sperm Protein family member (msp-36) [Caenorhabditis elegans] ref|NP_501762.1| Major Sperm Protein family member (msp-56) [Caenorhabditis elegans] ref|NP_501760.1| Major Sperm Protein family member (msp-10) [Caenorhabditis elegans] ref|NP_501722.1| Major Sperm Protein family member (msp-76) [Caenorhabditis elegans] sp|P05634|MSP10_CAEEL Major sperm protein 10/36/56/76 (MSP) emb|CAE59492.1| Hypothetical protein CBG02877 [Caenorhabditis briggsae] emb|CAE59433.1| Hypothetical protein CBG02806 [Caenorhabditis briggsae] emb|CAE59411.1| Hypothetical protein CBG02775 [Caenorhabditis briggsae] 2.0E-71
blast CAE60837 Hypothetical protein CBG04546 [Caenorhabditis briggsae] 3.0E-71
blast CAE59132 Hypothetical protein CBG02432 [Caenorhabditis briggsae] emb|CAE59019.1| Hypothetical protein CBG02296 [Caenorhabditis briggsae] emb|CAE59007.1| Hypothetical protein CBG02283 [Caenorhabditis briggsae] emb|CAE73212.1| Hypothetical protein CBG20617 [Caenorhabditis briggsae] emb|CAE73205.1| Hypothetical protein CBG20609 [Caenorhabditis briggsae] emb|CAE65094.1| Hypothetical protein CBG09953 [Caenorhabditis briggsae] 4.0E-71
Protein Domains
Database ID Description E-Value
Pfam IPR000535 EMBL-EBI Major sperm protein (MSP) domain 3.6E-35
Sequence
Target Sequence 
>C. ELEGANS:172853_X_AT
caaacccaaccaaacgcgaagatcgtctttaatgctccatacgatgacaagcacacctat
cacatcaaggtgatcaactcatcggctcgtcgtattggatatggtatcaagaccaccaat
atgaagagacttggagttgatccaccatgtggagttctcgatccaaaggaagctgtgctt
cttgctgtttcctgcgatgctttcgccttcggacaagaggataccaacaacgaccgtatc
actgttgagtggaccaacaccccggatggagctgccaagcaattccgtcgtgaatggttc
cag

BLASTn GenBank NR
Probe Info
Probe Sequence(5'-3') Probe X Probe Y Probe Interrogation
Position 		Strandedness
CAAACCCAACCAAACGCGAAGATCG 576 169 43 Antisense
GAAGATCGTCTTTAATGCTCCATAC 130 339 60 Antisense
ATGACAAGCACACCTATCACATCAA 301 45 86 Antisense
TCAAGGTGATCAACTCATCGGCTCG 150 633 107 Antisense
ACTCATCGGCTCGTCGTATTGGATA 662 99 119 Antisense
ATCCACCATGTGGAGTTCTCGATCC 171 41 182 Antisense
AGGAAGCTGTGCTTCTTGCTGTTTC 311 55 209 Antisense
ATGCTTTCGCCTTCGGACAAGAGGA 484 41 239 Antisense
ACTGTTGAGTGGACCAACACCCCGG 478 97 283 Antisense
GATGGAGCTGCCAAGCAATTCCGTC 555 407 307 Antisense
GCAATTCCGTCGTGAATGGTTCCAG 193 317 321 Antisense
Sequence Source Affymetrix Proprietary Database