[Home] | [Total List]

[172851_x_at] histone H2B

Description F17E9.9 /REP_DB=WormBase Gene ID /WP=CE07075 /GEN=his-34 /TR=O02656 /GB=AAC05103.1 /SUBMIT=ST.LOUIS /CHR=4 /FEA=Sanger Annotation /DEF=histone 2B
Cluster 6grp_high1_10_10 > 97      6grp_total > 97      4grp_total > 48      6grp_cgc > 68      6grp_high1_sub > In      6grp_cgc_sub > In      6grp_total_sub > Increase      6grp_rule_based > S6      4grp_rule_based > L3      

Scale
G range Absolute graph Relative graph Expression Table Dauer Comp.
4 776
1 2 3 4 range
A 107.5
(-3)
A 		448
(-0.1)
P 		803.8
(3)
P 		233.9
(-1.9)
P 		696
B 97.9
(-3)
A 		623.3
(1.1)
P 		874
(3)
P 		310.2
(-1.4)
P 		776
C 107.5
(-3)
A 		704.3
(3)
P 		533.1
(1.3)
P 		340.4
(-0.7)
P 		597
avr 104.3
(-3) 		591.9
(1.6) 		737
(3) 		294.8
(-1.2) 		633

1 : 1 state (S1, L1)
2 : dauer (ST, LT)
6 651
1 2 3 4 5 6 range
A 187.3
(-3)
A 		209.2
(-2.8)
P 		270
(-2.2)
P 		393.9
(-1)
P 		358.6
(-1.4)
P 		817.7
(3)
P 		630
B 185.1
(-3)
A 		195.2
(-2.9)
P 		327.9
(-1.7)
P 		362.2
(-1.4)
P 		638.5
(1.2)
P 		836.2
(3)
P 		651
C 189.7
(-3)
P 		248.3
(-2.5)
P 		240.4
(-2.5)
P 		240.5
(-2.5)
P 		692.6
(1.7)
P 		830.3
(3)
P 		641
avr 187.4
(-3) 		217.6
(-2.7) 		279.4
(-2.1) 		332.2
(-1.6) 		563.2
(0.5) 		828.1
(3) 		641
No Scale
G range Absolute graph Relative graph Expression Table Dauer Comp.
4 179
1 2 3 4 range
A 39.2
(-2.8)
A 		97.3
(-0.8)
P 		210.1
(3)
P 		34.2
(-3)
P 		176
B 31.2
(-3)
A 		153.9
(1.3)
P 		202.5
(3)
P 		66.1
(-1.8)
P 		171
C 35.6
(-3)
A 		202.5
(3)
P 		185.8
(2.4)
P 		57.4
(-2.2)
P 		167
avr 35.3
(-3) 		151.2
(1.2) 		199.5
(3) 		52.6
(-2.4) 		164

1 : 1 state (S1, L1)
2 : dauer (ST, LT)
6 277
1 2 3 4 5 6 range
A 34.5
(-3)
A 		74.4
(-1.5)
P 		58.8
(-2.1)
P 		99.9
(-0.6)
P 		108.2
(-0.3)
P 		199.1
(3)
P 		165
B 64.4
(-3)
A 		65
(-3)
P 		79.6
(-2.6)
P 		95.9
(-2.2)
P 		259.4
(1.7)
P 		311.8
(3)
P 		247
C 70.3
(-2.4)
P 		75.8
(-2.3)
P 		61.2
(-2.7)
P 		48.4
(-3)
P 		224.1
(1.6)
P 		277.9
(3)
P 		230
avr 56.4
(-3) 		71.7
(-2.6) 		66.5
(-2.7) 		81.4
(-2.3) 		197.2
(1.1) 		262.9
(3) 		207
NetAffx Links Cluster Members
Consensus/Exemplar
Group Members
GeneChip Array Information
Probe Set ID 172851_x_at
GeneChip Array C. elegans Genome Array
Organism Common Name Nematode
Probe Design Information
Transcript ID(Array Design) affy.Ce.9964
Sequence Type Exemplar sequence
Representative Public ID F17E9.9 NCBI
Target Description F17E9.9 /REP_DB=WormBase Gene ID /WP=CE07075 /GEN=his-34 /TR=O02656 /GB=AAC05103.1 /SUBMIT=ST.LOUIS /CHR=4 /FEA=Sanger Annotation /DEF=histone 2B
Cluster Evidence This cluster is supported by a Sanger Annotation.
Annotation Method Description
Annotation Description This probe set was annotated using the Matching Probes based pipeline to a RefSeq identifier using 1 transcript(s).
Annotation Grade This is a grade A annotation.
Annotation Transcript Cluster (# of Matching Probes) NM_069008(11), NM_069002(11)
Transcript Assignments
Representative
Transcript		 Description Matching Probes Related Probesets by Grade
NM_069008 NCBI Caenorhabditis elegans HIStone family member (his-34) (his-34) mRNA, complete cds. 11/11 None
NM_069002 NCBI Caenorhabditis elegans HIStone family member (his-29) (his-29) mRNA, complete cds. 11/11 None
SNAP00000000482 ENSEMBL cdna:SNAP chromosome:CEL140:IV:8335954:8336322:1 11/11 None
GENEFINDER00000000503 ENSEMBL cdna:GeneFinder chromosome:CEL140:IV:8335954:8336322:1 11/11 None
SNAP00000039430 ENSEMBL cdna:SNAP chromosome:CEL140:IV:8331026:8331394:-1 11/11 None
GENEFINDER00000039441 ENSEMBL cdna:GeneFinder chromosome:CEL140:IV:8331026:8331394:-1 11/11 None
F35H10.11 ENSEMBL cdna:known chromosome:CEL140:IV:8331026:8331394:-1 gene:F35H10.11 11/11 None
F17E9.9 ENSEMBL cdna:known chromosome:CEL140:IV:8335954:8336322:1 gene:F17E9.9 11/11 None
Annotation Notes
Cross Hybridizing mRNA Matched Probes Nature of Assignment Related Probesets by Grade
NM_072877 2/11 Cross Hyb Matching Probes A B 
NM_072893 2/11 Cross Hyb Matching Probes A B 
NM_068801 2/11 Cross Hyb Matching Probes A 
NM_072796 2/11 Cross Hyb Matching Probes A B 
NM_072894 2/11 Cross Hyb Matching Probes A B 
NM_072800 1/11 Cross Hyb Matching Probes A 
NM_069748 2/11 Cross Hyb Matching Probes A 
NM_064487 1/11 Cross Hyb Matching Probes A 
NM_064491 1/11 Cross Hyb Matching Probes A 
NM_064496 1/11 Cross Hyb Matching Probes A 
NM_074630 1/11 Cross Hyb Matching Probes A B 
NM_072878 2/11 Cross Hyb Matching Probes A B 
NM_069731 2/11 Cross Hyb Matching Probes A 
NM_069739 2/11 Cross Hyb Matching Probes A 
SNAP00000009813 1/11 Cross Hyb Matching Probes None
SNAP00000009817 1/11 Cross Hyb Matching Probes None
GENEFINDER00000009832 1/11 Cross Hyb Matching Probes None
GENEFINDER00000009842 1/11 Cross Hyb Matching Probes None
SNAP00000034712 1/11 Cross Hyb Matching Probes None
GENEFINDER00000034726 1/11 Cross Hyb Matching Probes None
SNAP00000002623 2/11 Cross Hyb Matching Probes None
GENEFINDER00000002629 2/11 Cross Hyb Matching Probes None
SNAP00000005172 2/11 Cross Hyb Matching Probes None
GENEFINDER00000005179 2/11 Cross Hyb Matching Probes None
SNAP00000035838 2/11 Cross Hyb Matching Probes None
GENEFINDER00000035849 2/11 Cross Hyb Matching Probes None
SNAP00000036323 2/11 Cross Hyb Matching Probes None
GENEFINDER00000036334 2/11 Cross Hyb Matching Probes None
SNAP00000015094 2/11 Cross Hyb Matching Probes None
SNAP00000015095 2/11 Cross Hyb Matching Probes None
GENEFINDER00000015150 2/11 Cross Hyb Matching Probes None
GENEFINDER00000015153 2/11 Cross Hyb Matching Probes None
SNAP00000018185 2/11 Cross Hyb Matching Probes None
SNAP00000018186 2/11 Cross Hyb Matching Probes None
GENEFINDER00000018201 2/11 Cross Hyb Matching Probes None
GENEFINDER00000018208 2/11 Cross Hyb Matching Probes None
SNAP00000027914 1/11 Cross Hyb Matching Probes None
GENEFINDER00000027921 1/11 Cross Hyb Matching Probes None
SNAP00000030771 2/11 Cross Hyb Matching Probes None
GENEFINDER00000030780 2/11 Cross Hyb Matching Probes None
GENEFINDER00000030783 1/11 Cross Hyb Matching Probes None
ZK131.9 1/11 Cross Hyb Matching Probes A 
ZK131.5 1/11 Cross Hyb Matching Probes A 
F08G2.1 1/11 Cross Hyb Matching Probes A 
F55G1.3 2/11 Cross Hyb Matching Probes A 
B0035.8 2/11 Cross Hyb Matching Probes A 
F54E12.4 2/11 Cross Hyb Matching Probes A 
H02I12.6 2/11 Cross Hyb Matching Probes A 
F45F2.12 2/11 Cross Hyb Matching Probes A B 
F45F2.2 1/11 Cross Hyb Matching Probes A 
F07B7.4 2/11 Cross Hyb Matching Probes A B 
F07B7.11 2/11 Cross Hyb Matching Probes A B 
K06C4.12 2/11 Cross Hyb Matching Probes R A B 
K06C4.4 2/11 Cross Hyb Matching Probes A B 
T10C6.11 1/11 Cross Hyb Matching Probes A B 
Genomic Alignment of Consensus/Exemplar Sequence
Assembly Wormbase March 2004
Alignment(s)
Position Identity Coverage Cytoband
chrII:13821702-13822071(+) 93.5 93.5
chrII:13818264-13818633(+) 93.5 93.5
chrV:8895152-8895518(+) 90.79 90.79
chrV:8853057-8853423(+) 90.79 90.79
chrIV:8335959-8336328(+) 100.0 100.0
chrIV:7486534-7486906(+) 92.68 92.68
chrIV:11324721-11325093(+) 91.33 91.33
chrII:13826623-13826992(-) 93.5 93.5
chrV:16042726-16043092(-) 90.79 90.79
chrV:8897688-8898054(-) 90.79 90.79
chrV:8855593-8855959(-) 90.79 90.79
chrV:8535304-8535670(-) 90.79 90.79
chrIV:8331031-8331400(-) 100.0 100.0
chrIV:11400391-11400763(-) 91.06 91.06
chrIV:11339711-11340083(-) 91.06 91.06
Public Domain and Genome References
Gene Title histone 2B
histone H2B
Gene Symbol his-34
his-29
Ensembl F35H10.11
F17E9.9
Entrez Gene 185332 Entrez gene
191679 Entrez gene
SwissProt P04255 EMBL-EBI
WormBase CE07075 Wormbase
CE07075 Wormbase
Functional Annotations
Ortholog
ID Title Organism
ATH1-121501:258707_AT histone H2B, putative at
ATH1-121501:258707_AT histone H2B, putative at
CANINE:1584743_AT similar to Histone H2B 291B cfa
CANINE_2:CFA.12195.11.A1_AT similar to Histone H2B 291B cfa
CANINE:1584743_AT similar to Histone H2B 291B cfa
CANINE_2:CFA.12195.11.A1_AT similar to Histone H2B 291B cfa
HG-U133_PLUS_2:208546_X_AT histone 1, H2bh hs
HG-U133A:208546_X_AT histone 1, H2bh hs
HG-FOCUS:208546_X_AT histone 1, H2bh hs
HG-U133A_2:208546_X_AT histone 1, H2bh hs
HUGENEFL:Z80781_AT histone 1, H2bh hs
U133_X3P:G4504268_3P_X_AT histone 1, H2bh hs
U133_X3P:208546_3P_X_AT histone 1, H2bh hs
HG-U133_PLUS_2:208546_X_AT histone 1, H2bh hs
HG-U133A:208546_X_AT histone 1, H2bh hs
HG-FOCUS:208546_X_AT histone 1, H2bh hs
HG-U133A_2:208546_X_AT histone 1, H2bh hs
HUGENEFL:Z80781_AT histone 1, H2bh hs
U133_X3P:G4504268_3P_X_AT histone 1, H2bh hs
U133_X3P:208546_3P_X_AT histone 1, H2bh hs
MOUSE430_2:1425868_AT Histone 2, H2bb (Hist2h2bb), mRNA mm
MOUSE430A_2:1425868_AT Histone 2, H2bb (Hist2h2bb), mRNA mm
MOE430A:1425868_AT Histone 2, H2bb (Hist2h2bb), mRNA mm
MOUSE430_2:1425868_AT Histone 2, H2bb (Hist2h2bb), mRNA mm
MOUSE430A_2:1425868_AT Histone 2, H2bb (Hist2h2bb), mRNA mm
MOE430A:1425868_AT Histone 2, H2bb (Hist2h2bb), mRNA mm
RAE230B:1396194_AT Similar to histone H2b-616 rn
RAT230_2:1396194_AT Similar to histone H2b-616 rn
RAE230B:1396194_AT Similar to histone H2b-616 rn
RAT230_2:1396194_AT Similar to histone H2b-616 rn
YEAST_2:1777846_AT One of two nearly identical (see HTB1) histone H2B subtypes required for chromatin assembly and chromosome function; Rad6p-Bre1p-Lge1p mediated ubiquitination regulates transcriptional activation, meiotic DSB formation and H3 methylation Sc
YEAST_2:1777846_AT One of two nearly identical (see HTB1) histone H2B subtypes required for chromatin assembly and chromosome function; Rad6p-Bre1p-Lge1p mediated ubiquitination regulates transcriptional activation, meiotic DSB formation and H3 methylation Sc
Gene Ontology
GO Biological Process (view graph)
ID Description Evidence Links
6334 nucleosome assembly inferred from electronic annotation QuickGO AmiGO
7001 chromosome organization and biogenesis (sensu Eukaryota) inferred from electronic annotation QuickGO AmiGO
GO Cellular Component (view graph)
ID Description Evidence Links
786 nucleosome inferred from electronic annotation QuickGO AmiGO
5634 nucleus inferred from electronic annotation QuickGO AmiGO
GO Molecular Function (view graph)
ID Description Evidence Links
3677 DNA binding inferred from electronic annotation QuickGO AmiGO
Protein Similarities
Method ID Description E-Value
blast CAB05832 Hypothetical protein ZK131.9 [Caenorhabditis elegans] emb|CAB05830.1| Hypothetical protein ZK131.5 [Caenorhabditis elegans] emb|CAB04061.1| Hypothetical protein F08G2.1 [Caenorhabditis elegans] gb|AAC05103.1| Histone protein 34 [Caenorhabditis elegans] emb|CAA33642.1| histone protein [Caenorhabditis elegans] gb|AAK84525.1| Histone protein 29 [Caenorhabditis elegans] ref|NP_501409.1| HIStone family member (his-34) [Caenorhabditis elegans] ref|NP_501403.1| HIStone family member (his-29) [Caenorhabditis elegans] ref|NP_496897.1| HIStone family member (his-44) [Caenorhabditis elegans] ref|NP_496892.1| HIStone family member (his-11) [Caenorhabditis elegans] ref|NP_496888.1| HIStone family member (his-15) [Caenorhabditis elegans] sp|P04255|H2B1_CAEEL Histone H2B 7.0E-50
blast AAF98225 Histone protein 20 [Caenorhabditis elegans] gb|AAF98230.1| Histone protein 22 [Caenorhabditis elegans] gb|AAC48023.1| Histone protein 8 [Caenorhabditis elegans] ref|NP_505295.1| HIStone family member (his-20) [Caenorhabditis elegans] ref|NP_505197.1| HIStone family member (his-8) [Caenorhabditis elegans] ref|NP_505294.1| HIStone family member (his-22) [Caenorhabditis elegans] sp|Q27894|H2B2_CAEEL Histone H2B 7.0E-50
blast CAB07654 Hypothetical protein T10C6.11 [Caenorhabditis elegans] ref|NP_507031.1| HIStone family member (his-4) [Caenorhabditis elegans] 7.0E-50
Protein Domains
Database ID Description E-Value
Pfam IPR007125 EMBL-EBI Histone core 8.9E-55
Sequence
Target Sequence 
>C. ELEGANS:172851_X_AT
gacgtcatgcccgtaaggagtcatactctgtctacatctaccgtgtcctcaagcaggttc
acccagatactggagtctcctcaaaggctatgtccatcatgaactctttcgtcaatgacg
tcttcgagcgtatcgccgctgaagcatctcgtcttgctcactacaacaagcgttctacca
tctcatcccgcgaaattcaaaccgctgttcgtttgattcttccaggagagcttgccaagc
acgccgtgtctgaggga

BLASTn GenBank NR
Probe Info
Probe Sequence(5'-3') Probe X Probe Y Probe Interrogation
Position 		Strandedness
GACGTCATGCCCGTAAGGAGTCATA 428 377 89 Antisense
GGAGTCATACTCTGTCTACATCTAC 11 517 105 Antisense
TCTACCGTGTCCTCAAGCAGGTTCA 635 613 125 Antisense
GGAGTCTCCTCAAAGGCTATGTCCA 291 517 160 Antisense
ATGTCCATCATGAACTCTTTCGTCA 571 49 178 Antisense
CAATGACGTCTTCGAGCGTATCGCC 69 183 201 Antisense
ATCTCGTCTTGCTCACTACAACAAG 51 31 234 Antisense
TACAACAAGCGTTCTACCATCTCAT 139 643 250 Antisense
ATCTCATCCCGCGAAATTCAAACCG 303 29 268 Antisense
CCGCTGTTCGTTTGATTCTTCCAGG 687 259 290 Antisense
TGCCAAGCACGCCGTGTCTGAGGGA 172 587 321 Antisense
Sequence Source Affymetrix Proprietary Database