[Home] | [Total List]

[172835_x_at] Core histones H2A, H2B, H3 and H4 /// histone H2A /// histone H2A

Description F08G2.2 /REP_DB=WormBase Gene ID /WP=CE04501 /GB=CAB04056.1 /SUBMIT=HINXTON /CHR=2 /FEA=Sanger Annotation /DEF=Core histones H2A, H2B, H3 and H4
Cluster 6grp_highest_10_10 > 79      6grp_high1_10_10 > 98      4grp_highest_8_8 > 11      4grp_high_8_8 > 47      6grp_highest_nonorm > 88      6grp_total > 96      4grp_total > 40      6grp_highest_sub > In      6grp_cgc > 68      6grp_high1_sub > In      6grp_cgc_sub > In      6grp_total_sub > Increase      6grp_rule_based > S6      4grp_rule_based > L3      

Scale
G range Absolute graph Relative graph Expression Table Dauer Comp.
4 1617
1 2 3 4 range
A 787.1
(-3)
P 		2090.3
(1.9)
P 		2386.4
(3)
P 		1654.6
(0.3)
P 		1599
B 769.8
(-3)
P 		1540.3
(0.5)
P 		2086.5
(3)
P 		1451.9
(0.1)
P 		1317
C 834.5
(-3)
P 		1698.3
(1.9)
P 		1889.8
(3)
P 		1262.4
(-0.6)
P 		1055
avr 797.1
(-3) 		1776.3
(1.4) 		2120.9
(3) 		1456.3
(-0) 		1324

1 : 1 state (S1, L1)
2 : dauer (ST, LT)
6 1287
1 2 3 4 5 6 range
A 796.7
(-3)
P 		944.1
(-2.3)
P 		980.5
(-2.1)
P 		1375.2
(-0.1)
P 		1540.4
(0.8)
P 		1977.2
(3)
P 		1181
B 937.2
(-3)
P 		1098.4
(-2.1)
P 		954.2
(-2.9)
P 		1246.6
(-1.2)
P 		1870.4
(2.5)
P 		1957.6
(3)
P 		1020
C 990.2
(-2.7)
P 		933.4
(-3)
P 		1011.6
(-2.6)
P 		1182.5
(-1.7)
P 		1729.4
(1.2)
P 		2083.2
(3)
P 		1150
avr 908
(-3) 		992
(-2.5) 		982.1
(-2.6) 		1268.1
(-1) 		1713.4
(1.4) 		2006
(3) 		1098
No Scale
G range Absolute graph Relative graph Expression Table Dauer Comp.
4 446
1 2 3 4 range
A 286.6
(-2.3)
P 		453.7
(0.3)
P 		623.8
(3)
P 		242.2
(-3)
P 		382
B 245.5
(-3)
P 		380.4
(0.4)
P 		483.5
(3)
P 		309.4
(-1.4)
P 		238
C 276.2
(-2.1)
P 		488.3
(0.7)
P 		658.7
(3)
P 		212.9
(-3)
P 		446
avr 269.4
(-2.7) 		440.8
(0.3) 		588.7
(3) 		254.8
(-3) 		334

1 : 1 state (S1, L1)
2 : dauer (ST, LT)
6 613
1 2 3 4 5 6 range
A 146.9
(-3)
P 		335.8
(0.4)
P 		213.5
(-1.8)
P 		348.8
(0.6)
P 		464.8
(2.7)
P 		481.4
(3)
P 		335
B 326.1
(-1.9)
P 		365.6
(-1.5)
P 		231.7
(-3)
P 		330.2
(-1.9)
P 		759.9
(3)
P 		730
(2.7)
P 		528
C 367
(-1.3)
P 		284.8
(-2.4)
P 		257.5
(-2.7)
P 		237.8
(-3)
P 		559.6
(1.2)
P 		697.4
(3)
P 		460
avr 280
(-2.3) 		328.7
(-1.6) 		234.2
(-3) 		305.6
(-1.9) 		594.8
(2.4) 		636.3
(3) 		402
NetAffx Links Cluster Members
Consensus/Exemplar
Group Members
GeneChip Array Information
Probe Set ID 172835_x_at
GeneChip Array C. elegans Genome Array
Organism Common Name Nematode
Probe Design Information
Transcript ID(Array Design) affy.Ce.3309
Sequence Type Exemplar sequence
Representative Public ID F08G2.2 NCBI
Target Description F08G2.2 /REP_DB=WormBase Gene ID /WP=CE04501 /GB=CAB04056.1 /SUBMIT=HINXTON /CHR=2 /FEA=Sanger Annotation /DEF=Core histones H2A, H2B, H3 and H4
Cluster Evidence This cluster is supported by a Sanger Annotation.
Annotation Method Description
Annotation Description This probe set was annotated using the Matching Probes based pipeline to a RefSeq identifier using 1 transcript(s).
Annotation Grade This is a grade A annotation.
Annotation Transcript Cluster (# of Matching Probes) NM_064486(11), NM_064490(11), NM_064497(11)
Transcript Assignments
Representative
Transcript		 Description Matching Probes Related Probesets by Grade
NM_064486 NCBI Caenorhabditis elegans HIStone family member (his-16) (his-16) mRNA, complete cds. 11/11 None
NM_064490 NCBI Caenorhabditis elegans HIStone family member (his-12) (his-12) mRNA, complete cds. 11/11 None
NM_064497 NCBI Caenorhabditis elegans HIStone family member (his-43) (his-43) mRNA, complete cds. 11/11 None
SNAP00000009812 ENSEMBL cdna:SNAP chromosome:CEL140:II:13817657:13818040:-1 11/11 None
SNAP00000009816 ENSEMBL cdna:SNAP chromosome:CEL140:II:13821095:13821478:-1 11/11 None
GENEFINDER00000009836 ENSEMBL cdna:GeneFinder chromosome:CEL140:II:13817657:13818040:-1 11/11 None
GENEFINDER00000009839 ENSEMBL cdna:GeneFinder chromosome:CEL140:II:13821095:13821478:-1 11/11 None
SNAP00000034713 ENSEMBL cdna:SNAP chromosome:CEL140:II:13827223:13827606:1 11/11 None
GENEFINDER00000034721 ENSEMBL cdna:GeneFinder chromosome:CEL140:II:13827223:13827606:1 11/11 None
ZK131.10 ENSEMBL cdna:known chromosome:CEL140:II:13817656:13818040:-1 gene:ZK131.10 11/11 None
ZK131.6 ENSEMBL cdna:known chromosome:CEL140:II:13821095:13821478:-1 gene:ZK131.6 11/11 None
F08G2.2 ENSEMBL cdna:known chromosome:CEL140:II:13827223:13827606:1 gene:F08G2.2 11/11 None
Annotation Notes
Cross Hybridizing mRNA Matched Probes Nature of Assignment Related Probesets by Grade
NM_072876 3/11 Cross Hyb Matching Probes A B 
NM_072892 3/11 Cross Hyb Matching Probes A B 
NM_072797 3/11 Cross Hyb Matching Probes A B 
NM_069003 1/11 Cross Hyb Matching Probes A B 
NM_069007 1/11 Cross Hyb Matching Probes A B 
NM_069749 2/11 Cross Hyb Matching Probes A B 
NM_072879 3/11 Cross Hyb Matching Probes A B 
NM_074631 3/11 Cross Hyb Matching Probes A B 
NM_060241 2/11 Cross Hyb Matching Probes A B 
NM_069730 2/11 Cross Hyb Matching Probes A B 
NM_069740 2/11 Cross Hyb Matching Probes A B 
NM_072895 3/11 Cross Hyb Matching Probes A B 
SNAP00000036752 2/11 Cross Hyb Matching Probes None
GENEFINDER00000036755 2/11 Cross Hyb Matching Probes None
SNAP00000000481 1/11 Cross Hyb Matching Probes None
GENEFINDER00000000494 1/11 Cross Hyb Matching Probes None
SNAP00000002624 2/11 Cross Hyb Matching Probes None
GENEFINDER00000002630 2/11 Cross Hyb Matching Probes None
SNAP00000035837 2/11 Cross Hyb Matching Probes None
GENEFINDER00000035847 2/11 Cross Hyb Matching Probes None
SNAP00000036324 2/11 Cross Hyb Matching Probes None
GENEFINDER00000036332 2/11 Cross Hyb Matching Probes None
SNAP00000039431 1/11 Cross Hyb Matching Probes None
GENEFINDER00000039433 1/11 Cross Hyb Matching Probes None
SNAP00000015093 3/11 Cross Hyb Matching Probes None
SNAP00000015096 3/11 Cross Hyb Matching Probes None
GENEFINDER00000015145 3/11 Cross Hyb Matching Probes None
GENEFINDER00000015151 3/11 Cross Hyb Matching Probes None
SNAP00000018184 3/11 Cross Hyb Matching Probes None
SNAP00000018187 3/11 Cross Hyb Matching Probes None
GENEFINDER00000018197 3/11 Cross Hyb Matching Probes None
GENEFINDER00000018200 3/11 Cross Hyb Matching Probes None
SNAP00000027915 3/11 Cross Hyb Matching Probes None
GENEFINDER00000027922 3/11 Cross Hyb Matching Probes None
SNAP00000030772 3/11 Cross Hyb Matching Probes None
GENEFINDER00000030788 3/11 Cross Hyb Matching Probes None
T23D8.6 2/11 Cross Hyb Matching Probes A B 
F35H10.1 1/11 Cross Hyb Matching Probes A B 
F17E9.13 1/11 Cross Hyb Matching Probes A B 
B0035.7 2/11 Cross Hyb Matching Probes A B 
F54E12.5 2/11 Cross Hyb Matching Probes A B 
H02I12.7 2/11 Cross Hyb Matching Probes A B 
F45F2.4 3/11 Cross Hyb Matching Probes A B 
F07B7.10 3/11 Cross Hyb Matching Probes A B 
F07B7.3 3/11 Cross Hyb Matching Probes A B 
K06C4.3 3/11 Cross Hyb Matching Probes A B 
K06C4.11 3/11 Cross Hyb Matching Probes A B 
T10C6.12 3/11 Cross Hyb Matching Probes A B 
Genomic Alignment of Consensus/Exemplar Sequence
Assembly Wormbase March 2004
Alignment(s)
Position Identity Coverage Cytoband
chrI:9997183-9997566(+) 92.45 92.45
chrII:13827219-13827603(+) 100.0 100.0
chrIV:11340388-11340768(+) 91.67 91.67
chrIV:11401068-11401448(+) 91.67 91.67
chrIV:8331653-8332036(+) 91.93 91.93
chrV:8535968-8536352(+) 92.45 92.45
chrV:8856257-8856641(+) 91.93 91.93
chrV:8898352-8898736(+) 91.93 91.93
chrII:13821091-13821475(-) 100.0 100.0
chrII:13817654-13818037(-) 99.74 99.74
chrIV:7485824-7486207(-) 91.67 91.67
chrIV:11324036-11324416(-) 91.67 91.67
chrIV:8335323-8335706(-) 91.93 91.93
chrV:8894470-8894854(-) 91.93 91.93
chrV:8852375-8852759(-) 91.93 91.93
Public Domain and Genome References
Gene Title Core histones H2A, H2B, H3 and H4
histone H2A
histone H2A
Gene Symbol his-43
his-16
his-12
Ensembl ZK131.10
ZK131.6
F08G2.2
Entrez Gene 175025 Entrez gene
175028 Entrez gene
175034 Entrez gene
SwissProt P09588 EMBL-EBI
WormBase CE04501 Wormbase
CE04501 Wormbase
CE04501 Wormbase
Functional Annotations
Ortholog
ID Title Organism
ATH1-121501:247651_AT histone H2A, putative at
ATH1-121501:247651_AT histone H2A, putative at
CANINE_2:CFAAFFX.20099.1.S1_S_AT similar to H2A histone family, member J isoform 2 cfa
CANINE_2:CFAAFFX.20099.1.S1_S_AT similar to H2A histone family, member J isoform 2 cfa
HG-U133_PLUS_2:228213_AT H2A histone family, member J hs
HG-U133B:228213_AT H2A histone family, member J hs
HG-U133_PLUS_2:224301_X_AT H2A histone family, member J hs
HG-U133B:224301_X_AT H2A histone family, member J hs
HG-U133_PLUS_2:220936_S_AT H2A histone family, member J hs
HG-U133A:220936_S_AT H2A histone family, member J hs
HG-U133A_2:220936_S_AT H2A histone family, member J hs
HU35KSUBA:RC_AA416963_AT H2A histone family, member J hs
HU35KSUBB:RC_N92659_AT H2A histone family, member J hs
U133_X3P:G13097821_3P_A_AT H2A histone family, member J hs
U133_X3P:HS.36727.2.S1_3P_A_AT H2A histone family, member J hs
HG-U133_PLUS_2:225245_X_AT H2A histone family, member J hs
HG-U133B:225245_X_AT H2A histone family, member J hs
HG-U95B:57175_AT H2A histone family, member J hs
HG-U95C:64194_AT H2A histone family, member J hs
HG-U95D:79412_AT H2A histone family, member J hs
HG-U133_PLUS_2:228213_AT H2A histone family, member J hs
HG-U133B:228213_AT H2A histone family, member J hs
HG-U133_PLUS_2:224301_X_AT H2A histone family, member J hs
HG-U133B:224301_X_AT H2A histone family, member J hs
HG-U133_PLUS_2:220936_S_AT H2A histone family, member J hs
HG-U133A:220936_S_AT H2A histone family, member J hs
HG-U133A_2:220936_S_AT H2A histone family, member J hs
HU35KSUBA:RC_AA416963_AT H2A histone family, member J hs
HU35KSUBB:RC_N92659_AT H2A histone family, member J hs
U133_X3P:G13097821_3P_A_AT H2A histone family, member J hs
U133_X3P:HS.36727.2.S1_3P_A_AT H2A histone family, member J hs
HG-U133_PLUS_2:225245_X_AT H2A histone family, member J hs
HG-U133B:225245_X_AT H2A histone family, member J hs
HG-U95B:57175_AT H2A histone family, member J hs
HG-U95C:64194_AT H2A histone family, member J hs
HG-U95D:79412_AT H2A histone family, member J hs
MOE430A:1424771_AT hypothetical protein E130307C13 mm
MOUSE430A_2:1424771_AT hypothetical protein E130307C13 mm
MOUSE430_2:1424771_AT hypothetical protein E130307C13 mm
MOE430A:1424772_AT hypothetical protein E130307C13 mm
MOUSE430A_2:1424772_AT hypothetical protein E130307C13 mm
MOUSE430_2:1424772_AT hypothetical protein E130307C13 mm
MG-U74AV2:104487_AT Hypothetical protein E130307C13, mRNA (cDNA clone MGC:36202 IMAGE:5055276) mm
MOUSE430A_2:1440252_AT Hypothetical protein E130307C13, mRNA (cDNA clone MGC:36202 IMAGE:5055276) mm
MOE430A:1440252_AT Hypothetical protein E130307C13, mRNA (cDNA clone MGC:36202 IMAGE:5055276) mm
MOUSE430_2:1440252_AT Hypothetical protein E130307C13, mRNA (cDNA clone MGC:36202 IMAGE:5055276) mm
MU11KSUBA:AA415691_AT Hypothetical protein E130307C13, mRNA (cDNA clone MGC:36202 IMAGE:5055276) mm
MU19KSUBB:TC27219_AT Hypothetical protein E130307C13, mRNA (cDNA clone MGC:36202 IMAGE:5055276) mm
MU19KSUBC:TC37251_AT Hypothetical protein E130307C13, mRNA (cDNA clone MGC:36202 IMAGE:5055276) mm
MOE430A:1424771_AT hypothetical protein E130307C13 mm
MOUSE430A_2:1424771_AT hypothetical protein E130307C13 mm
MOUSE430_2:1424771_AT hypothetical protein E130307C13 mm
MOE430A:1424772_AT hypothetical protein E130307C13 mm
MOUSE430A_2:1424772_AT hypothetical protein E130307C13 mm
MOUSE430_2:1424772_AT hypothetical protein E130307C13 mm
MG-U74AV2:104487_AT Hypothetical protein E130307C13, mRNA (cDNA clone MGC:36202 IMAGE:5055276) mm
MOUSE430A_2:1440252_AT Hypothetical protein E130307C13, mRNA (cDNA clone MGC:36202 IMAGE:5055276) mm
MOE430A:1440252_AT Hypothetical protein E130307C13, mRNA (cDNA clone MGC:36202 IMAGE:5055276) mm
MOUSE430_2:1440252_AT Hypothetical protein E130307C13, mRNA (cDNA clone MGC:36202 IMAGE:5055276) mm
MU11KSUBA:AA415691_AT Hypothetical protein E130307C13, mRNA (cDNA clone MGC:36202 IMAGE:5055276) mm
MU19KSUBB:TC27219_AT Hypothetical protein E130307C13, mRNA (cDNA clone MGC:36202 IMAGE:5055276) mm
MU19KSUBC:TC37251_AT Hypothetical protein E130307C13, mRNA (cDNA clone MGC:36202 IMAGE:5055276) mm
Gene Ontology
GO Biological Process (view graph)
ID Description Evidence Links
6334 nucleosome assembly inferred from electronic annotation QuickGO AmiGO
7001 chromosome organization and biogenesis (sensu Eukaryota) inferred from electronic annotation QuickGO AmiGO
GO Cellular Component (view graph)
ID Description Evidence Links
786 nucleosome inferred from electronic annotation QuickGO AmiGO
5634 nucleus inferred from electronic annotation QuickGO AmiGO
GO Molecular Function (view graph)
ID Description Evidence Links
3677 DNA binding inferred from electronic annotation QuickGO AmiGO
Protein Similarities
Method ID Description E-Value
blast CAE60212 Hypothetical protein CBG03776 [Caenorhabditis briggsae] 9.0E-42
Protein Domains
Database ID Description E-Value
Pfam IPR007125 EMBL-EBI Histone core 3.6E-55
Sequence
Target Sequence 
>C. ELEGANS:172835_X_AT
aagtcccgctcatcaagagccggactccaattcccagttggtcgtcttcaccgtattctt
cgcaaaggaaactacgctcaacgcgtcggagccggagccccagtctacttggccgctgtt
ctcgaatacctcgctgctgaggttctcgagttggccggtaacgctgcccgtgataacaag
aagacccgtatcgccccaagacatcttcaacttgccgtccgtaatgacgaagagttgaac
aaacttttggctggagtcacaatcgctcaaggaggagttcttccgaacatccaagc

BLASTn GenBank NR
Probe Info
Probe Sequence(5'-3') Probe X Probe Y Probe Interrogation
Position 		Strandedness
AAGTCCCGCTCATCAAGAGCCGGAC 284 159 61 Antisense
TCCAATTCCCAGTTGGTCGTCTTCA 208 587 86 Antisense
TCTTCACCGTATTCTTCGCAAAGGA 219 615 105 Antisense
GAAACTACGCTCAACGCGTCGGAGC 509 355 128 Antisense
TCGCTGCTGAGGTTCTCGAGTTGGC 380 597 191 Antisense
CGGTAACGCTGCCCGTGATAACAAG 637 243 216 Antisense
GATAACAAGAAGACCCGTATCGCCC 307 423 232 Antisense
TCGCCCCAAGACATCTTCAACTTGC 210 599 251 Antisense
TTCAACTTGCCGTCCGTAATGACGA 691 681 266 Antisense
TTGGCTGGAGTCACAATCGCTCAAG 677 705 307 Antisense
GAGGAGTTCTTCCGAACATCCAAGC 80 405 332 Antisense
Sequence Source Affymetrix Proprietary Database