|
|
Cluster Members Consensus/Exemplar Group Members |
GeneChip Array Information |
|
172833_x_at |
|
C. elegans Genome Array |
|
Nematode |
Probe Design Information |
|
affy.Ce.13427
|
|
Exemplar sequence
|
|
T10C6.13 NCBI
|
|
T10C6.13 /REP_DB=WormBase Gene ID /WP=CE03253 /GEN=his-2 /TR=Q9TW44 /GB=CAB07653.1 /SUBMIT=HINXTON /CHR=5 /FEA=Sanger Annotation /DEF=histone H3
|
This cluster is supported by a Sanger Annotation. |
Annotation Method Description |
|
This probe set was annotated using the Matching Probes based pipeline to a RefSeq identifier using 1 transcript(s). |
|
This is a grade A annotation. |
|
NM_074632(11) |
|
|
|
|
|
NM_074632 NCBI |
Caenorhabditis elegans HIStone family member (his-2) (his-2) mRNA, complete cds. |
11/11 |
None |
SNAP00000027916 ENSEMBL |
cdna:SNAP chromosome:CEL140:V:16044456:16044866:-1 |
11/11 |
None |
GENEFINDER00000027930 ENSEMBL |
cdna:GeneFinder chromosome:CEL140:V:16044456:16044866:-1 |
11/11 |
None |
T10C6.13 ENSEMBL |
cdna:known chromosome:CEL140:V:16044152:16044866:-1 gene:T10C6.13 |
11/11 |
None | |
NM_068803 |
2/11 |
Cross Hyb Matching Probes |
A |
NM_067207 |
1/11 |
Cross Hyb Matching Probes |
A B |
NM_072798 |
3/11 |
Cross Hyb Matching Probes |
A B |
NM_072896 |
3/11 |
Cross Hyb Matching Probes |
A B |
NM_072875 |
3/11 |
Cross Hyb Matching Probes |
A B |
NM_069006 |
2/11 |
Cross Hyb Matching Probes |
A B |
NM_072891 |
3/11 |
Cross Hyb Matching Probes |
A B |
SNAP00000016068 |
1/11 |
Cross Hyb Matching Probes |
None |
GENEFINDER00000016112 |
1/11 |
Cross Hyb Matching Probes |
None |
SNAP00000000480 |
2/11 |
Cross Hyb Matching Probes |
None |
GENEFINDER00000000500 |
2/11 |
Cross Hyb Matching Probes |
None |
SNAP00000005174 |
2/11 |
Cross Hyb Matching Probes |
None |
GENEFINDER00000005184 |
2/11 |
Cross Hyb Matching Probes |
None |
SNAP00000015092 |
3/11 |
Cross Hyb Matching Probes |
None |
GENEFINDER00000015146 |
3/11 |
Cross Hyb Matching Probes |
None |
SNAP00000018183 |
3/11 |
Cross Hyb Matching Probes |
None |
SNAP00000018188 |
3/11 |
Cross Hyb Matching Probes |
None |
GENEFINDER00000018196 |
3/11 |
Cross Hyb Matching Probes |
None |
GENEFINDER00000018198 |
3/11 |
Cross Hyb Matching Probes |
None |
SNAP00000030773 |
3/11 |
Cross Hyb Matching Probes |
None |
GENEFINDER00000030784 |
3/11 |
Cross Hyb Matching Probes |
None |
GENEFINDER00000013875 |
3/11 |
Cross Hyb Matching Probes |
None |
SNAP00000013868 |
4/11 |
Cross Hyb Matching Probes |
None |
Y49E10.6.2 |
1/11 |
Cross Hyb Matching Probes |
None |
Y49E10.6.1 |
1/11 |
Cross Hyb Matching Probes |
None |
F55G1.2 |
2/11 |
Cross Hyb Matching Probes |
A |
F17E9.10 |
2/11 |
Cross Hyb Matching Probes |
A B |
F45F2.13 |
3/11 |
Cross Hyb Matching Probes |
A B |
F07B7.5 |
3/11 |
Cross Hyb Matching Probes |
A B |
K06C4.13 |
3/11 |
Cross Hyb Matching Probes |
A B |
K06C4.5 |
3/11 |
Cross Hyb Matching Probes |
A B |
K03A1.1 |
4/11 |
Cross Hyb Matching Probes |
B | |
Genomic Alignment of Consensus/Exemplar Sequence |
|
Wormbase March 2004 |
|
|
|
|
|
chrII:13823541-13823952(+) |
90.27 |
90.27 |
|
chrII:13820103-13820514(+) |
90.27 |
90.27 |
|
chrV:8892625-8893036(+) |
96.84 |
96.84 |
|
chrV:8850530-8850941(+) |
96.84 |
96.84 |
|
chrX:7310054-7310464(+) |
96.59 |
96.59 |
|
chrII:13824742-13825153(-) |
90.27 |
90.27 |
|
chrV:16044455-16044866(-) |
100.0 |
100.0 |
|
chrV:8900169-8900580(-) |
96.59 |
96.59 |
|
chrV:8537155-8537566(-) |
96.35 |
96.35 |
| |
Public Domain and Genome References |
|
histone H3
|
|
his-2
|
|
T10C6.13
|
|
180074 Entrez gene
|
|
P08898 EMBL-EBI
|
|
CE03253 Wormbase
|
Functional Annotations |
|
|
|
|
ATH1-121501:262979_S_AT |
histone H3, putative |
at |
ATH1-121501:259387_AT |
histone H3, putative |
at |
CANINE_2:CFAAFFX.14172.1.S1_AT |
similar to H3 histone, family 3B |
cfa |
CANINE_2:CFAAFFX.2698.1.S1_S_AT |
similar to H3 histone, family 3B |
cfa |
CANINE_2:CFAAFFX.357.1.S1_X_AT |
similar to H3 histone, family 3B |
cfa |
HG-U133_PLUS_2:208575_AT |
histone 1, H3a |
hs |
HG-U133A:208575_AT |
histone 1, H3a |
hs |
HG-FOCUS:208575_AT |
histone 1, H3a |
hs |
HG-U133A_2:208575_AT |
histone 1, H3a |
hs |
HUGENEFL:Z46261_AT |
histone 1, H3a |
hs |
U133_X3P:G4504280_3P_X_AT |
histone 1, H3a |
hs |
U133_X3P:G4504280_3P_AT |
histone 1, H3a |
hs | |
|
|
|
|
|
6334 |
nucleosome assembly |
inferred from electronic annotation |
QuickGO AmiGO |
7001 |
chromosome organization and biogenesis (sensu Eukaryota) |
inferred from electronic annotation |
QuickGO AmiGO |
|
|
|
|
786 |
nucleosome |
inferred from electronic annotation |
QuickGO AmiGO |
5634 |
nucleus |
inferred from electronic annotation |
QuickGO AmiGO |
|
|
|
|
3677 |
DNA binding |
inferred from electronic annotation |
QuickGO AmiGO | |
|
|
|
|
|
blast |
CAB05834 |
Hypothetical protein ZK131.7 [Caenorhabditis elegans] emb|CAB05833.1| Hypothetical protein ZK131.3 [Caenorhabditis elegans] emb|CAB05831.1| Hypothetical protein ZK131.2 [Caenorhabditis elegans] emb|CAA97411.1| Hypothetical protein B0035.10 [Caenorhabditis elegans] emb|CAA92733.1| Hypothetical protein F22B3.2 [Caenorhabditis elegans] emb|CAB07653.1| Hypothetical protein T10C6.13 [Caenorhabditis elegans] emb|CAB05209.1| Hypothetical protein F54E12.1 [Caenorhabditis elegans] emb|CAB04057.1| Hypothetical protein F08G2.3 [Caenorhabditis elegans] gb|AAC05102.1| Histone protein 32 [Caenorhabditis elegans] gb|AAK84514.1| Histone protein 49 [Caenorhabditis elegans] gb|AAF98226.1| Histone protein 17 [Caenorhabditis elegans] gb|AAF98231.1| Histone protein 27 [Caenorhabditis elegans] emb|CAA33644.1| Histone protein [Caenorhabditis elegans] gb|AAB00650.1| Histone protein 59 [Caenorhabditis elegans] gb|AAC48033.1| Histone protein 6 [Caenorhabditis elegans] ref|NP_505292.1| HIStone family member (his-27) [Caenorhabditis elegans] ref|NP_505297.1| HIStone family member (his-17) [Caenorhabditis elegans] ref|NP_496890.1| HIStone family member (his-13) [Caenorhabditis elegans] ref|NP_505199.1| HIStone family member (his-6) [Caenorhabditis elegans] ref|NP_501204.1| F55G1.2 [Caenorhabditis elegans] ref|NP_502138.1| HIStone family member (his-55) [Caenorhabditis elegans] ref|NP_502153.1| HIStone family member (his-63) [Caenorhabditis elegans] ref|NP_496899.1| HIStone family member (his-42) [Caenorhabditis elegans] ref|NP_505276.1| HIStone family member (his-49) [Caenorhabditis elegans] ref|NP_502134.1| HIStone family member (his-45) [Caenorhabditis elegans] ref|NP_507033.1| HIStone family member (his-2) [Caenorhabditis elegans] ref|NP_501407.1| HIStone family member (his-32) [Caenorhabditis elegans] ref|NP_496895.1| HIStone family member (his-25) [Caenorhabditis elegans] ref|NP_496894.1| HIStone family member (his-9) [Caenorhabditis elegans] gb|AAG50235.1| histone H3 [Caenorhabditis elegans] pir||HSKW3 histone H3 - Caenorhabditis elegans |
5.0E-70 |
blast |
P08898 |
Histone H3 |
1.0E-69 |
blast |
AAH74969 |
H3/o protein [Homo sapiens] |
2.0E-68 | |
|
|
|
|
|
Pfam |
IPR007125 EMBL-EBI |
Histone core |
1.6E-29 | |
Sequence |
|
>C. ELEGANS:172833_X_AT
aaagcagctggccaccaaggcagctcgcaagtctgctccagcctctggaggagtcaagaa
gccacatcgttaccgtccaggaaccgtcgctctccgtgagatcagacgttaccagaagtc
taccgagctcctcatccgcagagcgccattccaacgccttgttcgtgaaattgctcaaga
tttcaagaccgacctccgcttccaatcttccgctgtcatggctcttcaagaggctgccga
ggcttacctcgtcggactcttcgaggacaccaacttgtgcgcaatccacgccaagcgagt
caccatcatgccaaaggac
BLASTn GenBank NR |
|
|
|
|
|
|
AAAGCAGCTGGCCACCAAGGCAGCT |
615 |
123 |
66 |
Antisense |
GTCTGCTCCAGCCTCTGGAGGAGTC |
544 |
471 |
96 |
Antisense |
GAGTCAAGAAGCCACATCGTTACCG |
422 |
399 |
116 |
Antisense |
CCGTCGCTCTCCGTGAGATCAGACG |
533 |
265 |
149 |
Antisense |
ACGTTACCAGAAGTCTACCGAGCTC |
167 |
95 |
171 |
Antisense |
TCCAACGCCTTGTTCGTGAAATTGC |
279 |
587 |
215 |
Antisense |
GCTCAAGATTTCAAGACCGACCTCC |
2 |
303 |
238 |
Antisense |
GGCTCTTCAAGAGGCTGCCGAGGCT |
400 |
539 |
285 |
Antisense |
TTACCTCGTCGGACTCTTCGAGGAC |
550 |
681 |
309 |
Antisense |
GAGGACACCAACTTGTGCGCAATCC |
301 |
405 |
328 |
Antisense |
GCGAGTCACCATCATGCCAAAGGAC |
193 |
291 |
360 |
Antisense | |
|
Affymetrix Proprietary Database |