[Home] | [Total List]

[172821_x_at] CUTICLE COLLAGEN 34

Description F52B11.4 /REP_DB=WormBase Gene ID /WP=CE18724 /TR=Q9XUE9 /GB=CAB05195.1 /SUBMIT=HINXTON /CHR=4 /FEA=Sanger Annotation /DEF=CUTICLE COLLAGEN 34
Cluster 6grp_highest_10_10 > 34      6grp_high1_10_10 > 43      6grp_highest_nonorm > 17      6grp_total > 10      4grp_total > 57      6grp_highest_sub > 02_03      6grp_cgc > 64      6grp_high1_sub > 02      6grp_total_sub > Hat      4grp_rule_based > L3      

Scale
G range Absolute graph Relative graph Expression Table Dauer Comp.
4 20320
1 2 3 4 range
A 4349.2
(-1.7)
P 		14974.5
(1.4)
P 		20424.9
(3)
P 		104.8
(-3)
A 		20320
B 4879.9
(-1.4)
P 		17547.4
(2.9)
P 		17877.1
(3)
P 		294.5
(-3)
A 		17583
C 4399.9
(-1.3)
P 		13442.1
(2.4)
P 		14884.9
(3)
P 		394.7
(-3)
A 		14490
avr 4543
(-1.5) 		15321.3
(2.2) 		17729
(3) 		264.7
(-3) 		17464

1 : 1 state (S1, L1)
2 : dauer (ST, LT)
6 12464
1 2 3 4 5 6 range
A 5052.2
(-3)
P 		15149.5
(3)
P 		13832
(2.2)
P 		10623.2
(0.3)
P 		11901.2
(1.1)
P 		9817.5
(-0.2)
P 		10097
B 6020.7
(-3)
P 		15540.9
(2)
P 		17516.6
(3)
P 		8921.3
(-1.5)
P 		10896.6
(-0.5)
P 		8471.6
(-1.7)
P 		11496
C 7538.5
(-2.6)
P 		16125.2
(3)
P 		13671.8
(1.4)
P 		8933.4
(-1.7)
P 		14892
(2.2)
P 		6863.4
(-3)
P 		9262
avr 6203.8
(-3) 		15605.2
(3) 		15006.8
(2.6) 		9492.6
(-0.9) 		12563.3
(1.1) 		8384.2
(-1.6) 		9401
No Scale
G range Absolute graph Relative graph Expression Table Dauer Comp.
4 5324
1 2 3 4 range
A 1583.5
(-1.2)
P 		3250.6
(0.6)
P 		5339.5
(3)
P 		15.3
(-3)
A 		5324
B 1556.2
(-0.9)
P 		4333.8
(3)
P 		4142.5
(2.7)
P 		62.8
(-3)
A 		4271
C 1456.5
(-1.4)
P 		3864.7
(1.4)
P 		5187.9
(3)
P 		66.5
(-3)
A 		5121
avr 1532.1
(-1.2) 		3816.4
(1.7) 		4890
(3) 		48.2
(-3) 		4842

1 : 1 state (S1, L1)
2 : dauer (ST, LT)
6 4457
1 2 3 4 5 6 range
A 931.3
(-3)
P 		5387.9
(3)
P 		3012.3
(-0.2)
P 		2694.3
(-0.6)
P 		3591.3
(0.6)
P 		2390.2
(-1)
P 		4457
B 2094.9
(-3)
P 		5172.9
(3)
P 		4253.6
(1.2)
P 		2363
(-2.5)
P 		4427.2
(1.5)
P 		3159
(-0.9)
P 		3078
C 2794.2
(-1.1)
P 		4920.3
(3)
P 		3479.7
(0.2)
P 		1796.5
(-3)
P 		4818.8
(2.8)
P 		2297.6
(-2)
P 		3124
avr 1940.1
(-3) 		5160.4
(3) 		3581.9
(0.1) 		2284.6
(-2.4) 		4279.1
(1.4) 		2615.6
(-1.7) 		3220
NetAffx Links Cluster Members
Consensus/Exemplar
Group Members
GeneChip Array Information
Probe Set ID 172821_x_at
GeneChip Array C. elegans Genome Array
Organism Common Name Nematode
Probe Design Information
Transcript ID(Array Design) affy.Ce.8964
Sequence Type Exemplar sequence
Representative Public ID F52B11.4 NCBI
Target Description F52B11.4 /REP_DB=WormBase Gene ID /WP=CE18724 /TR=Q9XUE9 /GB=CAB05195.1 /SUBMIT=HINXTON /CHR=4 /FEA=Sanger Annotation /DEF=CUTICLE COLLAGEN 34
Cluster Evidence This cluster is supported by a Sanger Annotation.
Annotation Method Description
Annotation Description This probe set was annotated using the Matching Probes based pipeline to a RefSeq identifier using 1 transcript(s).
Annotation Grade This is a grade A annotation.
Annotation Transcript Cluster (# of Matching Probes) NM_070299(11)
Transcript Assignments
Representative
Transcript		 Description Matching Probes Related Probesets by Grade
NM_070299 NCBI Caenorhabditis elegans COLlagen family member (col-133) (col-133) mRNA, complete cds. 11/11 None
SNAP00000035582 ENSEMBL cdna:SNAP chromosome:CEL140:IV:14098337:14099321:-1 11/11 None
GENEFINDER00000035589 ENSEMBL cdna:GeneFinder chromosome:CEL140:IV:14098337:14099321:-1 11/11 None
F52B11.4 ENSEMBL cdna:known chromosome:CEL140:IV:14098337:14099321:-1 gene:F52B11.4 11/11 None
Annotation Notes
Cross Hybridizing mRNA Matched Probes Nature of Assignment Related Probesets by Grade
NM_067008 2/11 Cross Hyb Matching Probes A 
NM_067009 1/11 Cross Hyb Matching Probes A 
NM_073276 1/11 Cross Hyb Matching Probes A 
NM_073277 2/11 Cross Hyb Matching Probes A 
NM_059689 1/11 Cross Hyb Matching Probes A 
NM_063960 1/11 Cross Hyb Matching Probes None
NM_058687 1/11 Cross Hyb Matching Probes A 
NM_069466 1/11 Cross Hyb Matching Probes A 
NM_067504 2/11 Cross Hyb Matching Probes A 
NM_073485 1/11 Cross Hyb Matching Probes A 
NM_073487 1/11 Cross Hyb Matching Probes A 
NM_066413 1/11 Cross Hyb Matching Probes A 
NM_069896 1/11 Cross Hyb Matching Probes A 
NM_071851 1/11 Cross Hyb Matching Probes A 
NM_078262 1/11 Cross Hyb Matching Probes A 
NM_078263 1/11 Cross Hyb Matching Probes A 
NM_072973 1/11 Cross Hyb Matching Probes A 
NM_072975 1/11 Cross Hyb Matching Probes None
NM_069971 1/11 Cross Hyb Matching Probes A 
NM_073083 2/11 Cross Hyb Matching Probes A 
NM_061512 1/11 Cross Hyb Matching Probes A 
NM_067299 2/11 Cross Hyb Matching Probes A 
NM_067302 1/11 Cross Hyb Matching Probes A 
NM_058793 1/11 Cross Hyb Matching Probes A 
NM_063358 2/11 Cross Hyb Matching Probes A 
NM_058794 1/11 Cross Hyb Matching Probes None
NM_068872 1/11 Cross Hyb Matching Probes A 
NM_077468 1/11 Cross Hyb Matching Probes None
NM_073899 1/11 Cross Hyb Matching Probes A 
NM_073933 1/11 Cross Hyb Matching Probes A 
NM_069299 1/11 Cross Hyb Matching Probes A 
NM_072334 1/11 Cross Hyb Matching Probes A 
NM_067007 1/11 Cross Hyb Matching Probes A 
NM_001027492 1/11 Cross Hyb Matching Probes None
NM_001027491 1/11 Cross Hyb Matching Probes None
NM_068118 1/11 Cross Hyb Matching Probes A 
NM_069714 1/11 Cross Hyb Matching Probes A 
NM_067737 1/11 Cross Hyb Matching Probes A 
NM_077559 1/11 Cross Hyb Matching Probes A 
NM_069715 1/11 Cross Hyb Matching Probes A 
NM_063909 1/11 Cross Hyb Matching Probes None
NM_063181 1/11 Cross Hyb Matching Probes None
NM_182112 1/11 Cross Hyb Matching Probes B 
SNAP00000007970 1/11 Cross Hyb Matching Probes None
GENEFINDER00000007974 1/11 Cross Hyb Matching Probes None
SNAP00000038906 1/11 Cross Hyb Matching Probes None
GENEFINDER00000038915 1/11 Cross Hyb Matching Probes None
SNAP00000038907 1/11 Cross Hyb Matching Probes None
GENEFINDER00000038912 1/11 Cross Hyb Matching Probes None
GENEFINDER00000040901 1/11 Cross Hyb Matching Probes None
SNAP00000040894 1/11 Cross Hyb Matching Probes None
SNAP00000003625 1/11 Cross Hyb Matching Probes None
GENEFINDER00000003631 1/11 Cross Hyb Matching Probes None
SNAP00000004358 2/11 Cross Hyb Matching Probes None
GENEFINDER00000004367 1/11 Cross Hyb Matching Probes None
SNAP00000014220 1/11 Cross Hyb Matching Probes None
SNAP00000014221 1/11 Cross Hyb Matching Probes None
GENEFINDER00000014231 1/11 Cross Hyb Matching Probes None
SNAP00000036390 1/11 Cross Hyb Matching Probes None
GENEFINDER00000036401 1/11 Cross Hyb Matching Probes None
SNAP00000036391 1/11 Cross Hyb Matching Probes None
GENEFINDER00000036400 1/11 Cross Hyb Matching Probes None
SNAP00000036392 1/11 Cross Hyb Matching Probes None
GENEFINDER00000036395 1/11 Cross Hyb Matching Probes None
SNAP00000034500 1/11 Cross Hyb Matching Probes None
GENEFINDER00000034516 1/11 Cross Hyb Matching Probes None
SNAP00000032557 1/11 Cross Hyb Matching Probes None
GENEFINDER00000032568 1/11 Cross Hyb Matching Probes None
SNAP00000035101 2/11 Cross Hyb Matching Probes None
GENEFINDER00000035107 2/11 Cross Hyb Matching Probes None
GENEFINDER00000000294 1/11 Cross Hyb Matching Probes None
SNAP00000005950 1/11 Cross Hyb Matching Probes None
SNAP00000005951 1/11 Cross Hyb Matching Probes None
GENEFINDER00000005959 1/11 Cross Hyb Matching Probes None
GENEFINDER00000005960 1/11 Cross Hyb Matching Probes None
SNAP00000015232 2/11 Cross Hyb Matching Probes None
GENEFINDER00000015234 2/11 Cross Hyb Matching Probes None
SNAP00000017748 1/11 Cross Hyb Matching Probes None
GENEFINDER00000017752 1/11 Cross Hyb Matching Probes None
SNAP00000023158 1/11 Cross Hyb Matching Probes None
GENEFINDER00000023159 1/11 Cross Hyb Matching Probes None
SNAP00000023282 1/11 Cross Hyb Matching Probes None
GENEFINDER00000023293 1/11 Cross Hyb Matching Probes None
SNAP00000033943 1/11 Cross Hyb Matching Probes None
GENEFINDER00000033946 1/11 Cross Hyb Matching Probes None
SNAP00000043526 1/11 Cross Hyb Matching Probes None
GENEFINDER00000043530 1/11 Cross Hyb Matching Probes None
SNAP00000043808 2/11 Cross Hyb Matching Probes None
GENEFINDER00000043818 2/11 Cross Hyb Matching Probes None
SNAP00000002816 1/11 Cross Hyb Matching Probes None
SNAP00000002817 2/11 Cross Hyb Matching Probes None
GENEFINDER00000002822 2/11 Cross Hyb Matching Probes None
GENEFINDER00000002824 1/11 Cross Hyb Matching Probes None
SNAP00000007051 1/11 Cross Hyb Matching Probes None
SNAP00000007440 2/11 Cross Hyb Matching Probes None
GENEFINDER00000007452 2/11 Cross Hyb Matching Probes None
SNAP00000011265 1/11 Cross Hyb Matching Probes None
GENEFINDER00000011290 1/11 Cross Hyb Matching Probes None
SNAP00000011428 1/11 Cross Hyb Matching Probes None
GENEFINDER00000011431 1/11 Cross Hyb Matching Probes None
SNAP00000017929 1/11 Cross Hyb Matching Probes None
SNAP00000017931 1/11 Cross Hyb Matching Probes None
GENEFINDER00000017933 1/11 Cross Hyb Matching Probes None
SNAP00000023009 1/11 Cross Hyb Matching Probes None
GENEFINDER00000023017 1/11 Cross Hyb Matching Probes None
GENEFINDER00000023019 1/11 Cross Hyb Matching Probes None
SNAP00000023063 1/11 Cross Hyb Matching Probes None
GENEFINDER00000023069 1/11 Cross Hyb Matching Probes None
SNAP00000035387 1/11 Cross Hyb Matching Probes None
GENEFINDER00000035400 1/11 Cross Hyb Matching Probes None
SNAP00000037973 1/11 Cross Hyb Matching Probes None
GENEFINDER00000037983 1/11 Cross Hyb Matching Probes None
SNAP00000041958 1/11 Cross Hyb Matching Probes None
GENEFINDER00000041968 1/11 Cross Hyb Matching Probes None
Y54E10BL.2 1/11 Cross Hyb Matching Probes A 
T28F2.6 1/11 Cross Hyb Matching Probes A 
T28F2.8 1/11 Cross Hyb Matching Probes A 
C15A11.5 1/11 Cross Hyb Matching Probes A 
T13B5.4 1/11 Cross Hyb Matching Probes A 
ZK1290.3a 1/11 Cross Hyb Matching Probes A B 
ZK1290.3b 1/11 Cross Hyb Matching Probes B 
M195.1 2/11 Cross Hyb Matching Probes A 
C09G5.5 1/11 Cross Hyb Matching Probes A 
F38A3.1 1/11 Cross Hyb Matching Probes A 
F09G8.6 1/11 Cross Hyb Matching Probes A 
K04H4.1b 1/11 Cross Hyb Matching Probes A 
K04H4.1a 1/11 Cross Hyb Matching Probes A 
W05B2.6 1/11 Cross Hyb Matching Probes A 
W05B2.5 2/11 Cross Hyb Matching Probes A 
W05B2.1 1/11 Cross Hyb Matching Probes A 
F14F7.1.2 1/11 Cross Hyb Matching Probes A 
K02D7.3 2/11 Cross Hyb Matching Probes A 
Y38C1BA.3 1/11 Cross Hyb Matching Probes R A 
F30B5.1 1/11 Cross Hyb Matching Probes A 
C46A5.3 1/11 Cross Hyb Matching Probes A 
T05A1.2 1/11 Cross Hyb Matching Probes A 
C24F3.6 1/11 Cross Hyb Matching Probes None
F54D1.2 1/11 Cross Hyb Matching Probes R A 
F54D1.3 1/11 Cross Hyb Matching Probes R A 
M18.1 1/11 Cross Hyb Matching Probes A 
F08G5.4 1/11 Cross Hyb Matching Probes A 
F41F3.4 1/11 Cross Hyb Matching Probes A 
T15B7.5 1/11 Cross Hyb Matching Probes A 
B0222.6 1/11 Cross Hyb Matching Probes A 
B0222.8 1/11 Cross Hyb Matching Probes A 
T06E4.6 2/11 Cross Hyb Matching Probes A 
F15H10.2 1/11 Cross Hyb Matching Probes A 
F15H10.1.2 3/11 Cross Hyb Matching Probes A 
F15H10.1.1 2/11 Cross Hyb Matching Probes A 
F55C10.2 1/11 Cross Hyb Matching Probes A 
F55C10.3 1/11 Cross Hyb Matching Probes A 
F57B1.4.2 1/11 Cross Hyb Matching Probes None
C50B6.4 1/11 Cross Hyb Matching Probes A 
Y2H9A.3 1/11 Cross Hyb Matching Probes A 
C34F6.2 1/11 Cross Hyb Matching Probes A 
C44C10.1 1/11 Cross Hyb Matching Probes A 
F01G12.5b.1 1/11 Cross Hyb Matching Probes A 
F01G12.5b.2 1/11 Cross Hyb Matching Probes A 
F01G12.5a 1/11 Cross Hyb Matching Probes A 
Genomic Alignment of Consensus/Exemplar Sequence
Assembly Wormbase March 2004
Alignment(s)
Position Identity Coverage Cytoband
chrIV:14098342-14099327(-) 93.55 100.0
Public Domain and Genome References
Gene Title CUTICLE COLLAGEN 34
Gene Symbol col-133
Ensembl F52B11.4
Entrez Gene 186083 Entrez gene
SwissProt Q9XUE9 EMBL-EBI
WormBase CE18724 Wormbase
Functional Annotations
Gene Ontology
GO Biological Process (view graph)
ID Description Evidence Links
6817 phosphate transport inferred from electronic annotation QuickGO AmiGO
GO Cellular Component (view graph)
ID Description Evidence Links
5737 cytoplasm inferred from electronic annotation QuickGO AmiGO
GO Molecular Function (view graph)
ID Description Evidence Links
42302 structural constituent of cuticle inferred from electronic annotation QuickGO AmiGO
Protein Similarities
Method ID Description E-Value
blast CAB05195 Hypothetical protein F52B11.4 [Caenorhabditis elegans] ref|NP_502700.1| COLlagen family member (col-133) [Caenorhabditis elegans] 4.0E-46
blast CAE71356 Hypothetical protein CBG18259 [Caenorhabditis briggsae] 4.0E-42
blast CAB03475 Hypothetical protein W05B2.1 [Caenorhabditis elegans] ref|NP_499410.1| COLlagen family member (col-94) [Caenorhabditis elegans] 1.0E-41
Protein Domains
Database ID Description E-Value
Pfam IPR002486 EMBL-EBI Nematode cuticle collagen, N-terminal 1.4E-10
Pfam IPR008160 EMBL-EBI Collagen triple helix repeat 1.8E-7
Pfam IPR008160 EMBL-EBI Collagen triple helix repeat 6.8E-12
Trans Membrane
ID Number Of Domains Domain Boundaries
NP_502700.1 1 12-34
F52B11.4 1 12-34
SNAP00000035582 1 12-34
GENEFINDER00000035589 1 12-34
Sequence
Target Sequence 
>C. ELEGANS:172821_X_AT
aggaggttcatgctccggatgctgtcttccaggagctgctggaccagctggaactccagg
aaagccaggaagaccaggacgtccaggagcagctggacttccaggaaacccagggcgccc
accagcacagccatgtgagccaatcactccaccaccatgcaagccatgtccacaaggacc
agcaggagctccaggagcaccaggaccacaaggagatgccggagcaccaggagcaccagg
acaaggatccggagctggagctccaggaccagctggaccaaagggagcctcaggagcacc
aggaaacccaggacaagccggagctccaggacagccaggagctgacgctcaatccgagtc
tattccaggagcaccaggacaagctggaccacaaggaccaccaggaccggctggatcccc
aggagccccaggaggaccaggacaaccaggagctccaggacagaagggaccatctggagc
accaggacaaccaggagccgacggaaatccaggagcaccaggacaaccaggac