[Home] | [Total List]

[172820_x_at] collagen

Description F23H12.4 /REP_DB=WormBase Gene ID /WP=CE05707 /GEN=sqt-3 /TR=Q19763 /GB=CAA98942.1 /SUBMIT=HINXTON /CHR=5 /FEA=Sanger Annotation /DEF=collagen
Cluster 6grp_highest_10_10 > 18      6grp_high1_10_10 > 62      4grp_highest_8_8 > 09      4grp_high_8_8 > 53      6grp_highest_nonorm > 09      6grp_total > 72      4grp_total > 58      6grp_highest_sub > 04_05      6grp_cgc > 74      6grp_high1_sub > 03      6grp_cgc_sub > 02_03_04_05      6grp_total_sub > Hat      6grp_rule_based > S3      4grp_rule_based > L3      

Scale
G range Absolute graph Relative graph Expression Table Dauer Comp.
4 32321
1 2 3 4 range
A 14847.1
(-0.9)
P 		33562.3
(2.6)
P 		35578
(3)
P 		3315.3
(-3)
P 		32263
B 18916.1
(0.2)
P 		30278.6
(2.5)
P 		32969.9
(3)
P 		3330.5
(-3)
P 		29639
C 17584.8
(0.5)
P 		27997.5
(3)
P 		25572.7
(2.4)
P 		3257.5
(-3)
P 		24740
avr 17116
(-0) 		30612.8
(2.8) 		31373.5
(3) 		3301.1
(-3) 		28072

1 : 1 state (S1, L1)
2 : dauer (ST, LT)
6 14786
1 2 3 4 5 6 range
A 16529.9
(-3)
P 		25211.6
(1)
P 		27589.3
(2.1)
P 		29470.3
(3)
P 		27828.6
(2.2)
P 		20136.7
(-1.3)
P 		12940
B 16026.6
(-3)
P 		23545.6
(0.1)
P 		30679.5
(3)
P 		25604
(0.9)
P 		22326.1
(-0.4)
P 		16559.3
(-2.8)
P 		14653
C 17343.8
(-2.6)
P 		25367.3
(0.7)
P 		29015.6
(2.3)
P 		29522.5
(2.5)
P 		30812.2
(3)
P 		16389.1
(-3)
P 		14423
avr 16633.4
(-3) 		24708.2
(0.9) 		29094.8
(3) 		28198.9
(2.6) 		26989
(2) 		17695
(-2.5) 		12461
No Scale
G range Absolute graph Relative graph Expression Table Dauer Comp.
4 8816
1 2 3 4 range
A 5405.8
(0.3)
P 		7285.5
(1.6)
P 		9300.8
(3)
P 		485.3
(-3)
P 		8816
B 6032.2
(1.6)
P 		7478.1
(2.9)
P 		7639.9
(3)
P 		709.7
(-3)
P 		6930
C 5821.1
(0.8)
P 		8049.4
(2.4)
P 		8912.9
(3)
P 		549.3
(-3)
P 		8364
avr 5753
(0.9) 		7604.3
(2.2) 		8617.9
(3) 		581.4
(-3) 		8037

1 : 1 state (S1, L1)
2 : dauer (ST, LT)
6 6923
1 2 3 4 5 6 range
A 3047.2
(-3)
P 		8966.5
(3)
P 		6008.4
(0)
P 		7474.4
(1.5)
P 		8397.5
(2.4)
P 		4902.6
(-1.1)
P 		5919
B 5576.5
(-3)
P 		7837.4
(0.9)
P 		7449.9
(0.2)
P 		6781.6
(-0.9)
P 		9070.8
(3)
P 		6174.9
(-2)
P 		3494
C 6428.6
(-1.7)
P 		7740.3
(0)
P 		7385
(-0.5)
P 		5937
(-2.4)
P 		9970.4
(3)
P 		5486.4
(-3)
P 		4484
avr 5017.4
(-3) 		8181.4
(1.6) 		6947.8
(-0.2) 		6731
(-0.5) 		9146.2
(3) 		5521.3
(-2.3) 		4129
NetAffx Links Cluster Members
Consensus/Exemplar
Group Members
GeneChip Array Information
Probe Set ID 172820_x_at
GeneChip Array C. elegans Genome Array
Organism Common Name Nematode
Probe Design Information
Transcript ID(Array Design) affy.Ce.13954
Sequence Type Exemplar sequence
Representative Public ID F23H12.4 NCBI
Target Description F23H12.4 /REP_DB=WormBase Gene ID /WP=CE05707 /GEN=sqt-3 /TR=Q19763 /GB=CAA98942.1 /SUBMIT=HINXTON /CHR=5 /FEA=Sanger Annotation /DEF=collagen
Cluster Evidence This cluster is supported by a Sanger Annotation.
Annotation Method Description
Annotation Description This probe set was annotated using the Matching Probes based pipeline to a RefSeq identifier using 1 transcript(s).
Annotation Grade This is a grade A annotation.
Annotation Transcript Cluster (# of Matching Probes) NM_073694(11)
Transcript Assignments
Representative
Transcript		 Description Matching Probes Related Probesets by Grade
NM_073694 NCBI Caenorhabditis elegans F23H12.4 (collagen) mRNA, complete cds. 11/11 None
SNAP00000020011 ENSEMBL cdna:SNAP chromosome:CEL140:V:12355744:12356668:1 11/11 None
GENEFINDER00000020025 ENSEMBL cdna:GeneFinder chromosome:CEL140:V:12355609:12356668:1 11/11 None
F23H12.4.2 ENSEMBL cdna:known chromosome:CEL140:V:12355582:12357069:1 gene:F23H12.4 11/11 A 
F23H12.4.1 ENSEMBL cdna:known chromosome:CEL140:V:12355582:12356902:1 gene:F23H12.4 11/11 A 
Annotation Notes
Cross Hybridizing mRNA Matched Probes Nature of Assignment Related Probesets by Grade
NM_181973 1/11 Cross Hyb Matching Probes None
NM_073276 1/11 Cross Hyb Matching Probes A 
NM_073277 1/11 Cross Hyb Matching Probes A 
NM_063960 1/11 Cross Hyb Matching Probes A 
NM_067556 1/11 Cross Hyb Matching Probes A 
NM_069466 1/11 Cross Hyb Matching Probes A 
NM_066132 1/11 Cross Hyb Matching Probes A 
NM_067504 1/11 Cross Hyb Matching Probes A 
NM_071851 2/11 Cross Hyb Matching Probes None
NM_064264 1/11 Cross Hyb Matching Probes A 
NM_068749 1/11 Cross Hyb Matching Probes A 
NM_070565 1/11 Cross Hyb Matching Probes A 
NM_078262 1/11 Cross Hyb Matching Probes A 
NM_078263 1/11 Cross Hyb Matching Probes A 
NM_069160 1/11 Cross Hyb Matching Probes A 
NM_001029563 2/11 Cross Hyb Matching Probes None
NM_067581 1/11 Cross Hyb Matching Probes A 
NM_069971 1/11 Cross Hyb Matching Probes A 
NM_073083 1/11 Cross Hyb Matching Probes A 
NM_067299 1/11 Cross Hyb Matching Probes None
NM_077846 1/11 Cross Hyb Matching Probes A 
NM_067302 1/11 Cross Hyb Matching Probes A 
NM_058794 1/11 Cross Hyb Matching Probes None
NM_068872 1/11 Cross Hyb Matching Probes A 
NM_073899 1/11 Cross Hyb Matching Probes A 
NM_059844 1/11 Cross Hyb Matching Probes A 
NM_073085 2/11 Cross Hyb Matching Probes A 
NM_001027491 1/11 Cross Hyb Matching Probes None
NM_072124 1/11 Cross Hyb Matching Probes None
NM_066328 1/11 Cross Hyb Matching Probes A 
NM_072673 1/11 Cross Hyb Matching Probes A 
NM_059612 1/11 Cross Hyb Matching Probes A 
NM_061234 2/11 Cross Hyb Matching Probes A 
NM_067468 1/11 Cross Hyb Matching Probes A 
NM_073652 1/11 Cross Hyb Matching Probes A 
SNAP00000037655 1/11 Cross Hyb Matching Probes None
GENEFINDER00000037666 1/11 Cross Hyb Matching Probes None
SNAP00000038907 1/11 Cross Hyb Matching Probes None
GENEFINDER00000038912 1/11 Cross Hyb Matching Probes None
SNAP00000032247 1/11 Cross Hyb Matching Probes None
GENEFINDER00000032257 1/11 Cross Hyb Matching Probes None
SNAP00000006684 1/11 Cross Hyb Matching Probes None
GENEFINDER00000006692 1/11 Cross Hyb Matching Probes None
SNAP00000020588 1/11 Cross Hyb Matching Probes None
GENEFINDER00000020591 1/11 Cross Hyb Matching Probes None
SNAP00000043178 2/11 Cross Hyb Matching Probes None
GENEFINDER00000043184 2/11 Cross Hyb Matching Probes None
SNAP00000032557 1/11 Cross Hyb Matching Probes None
GENEFINDER00000032568 1/11 Cross Hyb Matching Probes None
SNAP00000010839 1/11 Cross Hyb Matching Probes None
GENEFINDER00000010850 1/11 Cross Hyb Matching Probes None
SNAP00000035101 1/11 Cross Hyb Matching Probes None
SNAP00000017877 1/11 Cross Hyb Matching Probes None
GENEFINDER00000017880 1/11 Cross Hyb Matching Probes None
SNAP00000000290 1/11 Cross Hyb Matching Probes None
GENEFINDER00000000294 1/11 Cross Hyb Matching Probes None
SNAP00000000185 1/11 Cross Hyb Matching Probes None
GENEFINDER00000000214 1/11 Cross Hyb Matching Probes None
SNAP00000003708 1/11 Cross Hyb Matching Probes None
GENEFINDER00000003712 1/11 Cross Hyb Matching Probes None
SNAP00000015232 1/11 Cross Hyb Matching Probes None
GENEFINDER00000015234 1/11 Cross Hyb Matching Probes None
SNAP00000025529 1/11 Cross Hyb Matching Probes None
GENEFINDER00000025537 1/11 Cross Hyb Matching Probes None
SNAP00000028014 1/11 Cross Hyb Matching Probes None
GENEFINDER00000028017 1/11 Cross Hyb Matching Probes None
SNAP00000033329 1/11 Cross Hyb Matching Probes None
GENEFINDER00000033337 1/11 Cross Hyb Matching Probes None
SNAP00000041561 1/11 Cross Hyb Matching Probes None
GENEFINDER00000041576 1/11 Cross Hyb Matching Probes None
SNAP00000042867 1/11 Cross Hyb Matching Probes None
GENEFINDER00000042874 1/11 Cross Hyb Matching Probes None
SNAP00000043526 1/11 Cross Hyb Matching Probes None
GENEFINDER00000043530 1/11 Cross Hyb Matching Probes None
SNAP00000043808 1/11 Cross Hyb Matching Probes None
GENEFINDER00000043818 1/11 Cross Hyb Matching Probes None
SNAP00000002816 1/11 Cross Hyb Matching Probes None
SNAP00000002817 1/11 Cross Hyb Matching Probes None
GENEFINDER00000002822 1/11 Cross Hyb Matching Probes None
GENEFINDER00000002824 1/11 Cross Hyb Matching Probes None
SNAP00000007440 1/11 Cross Hyb Matching Probes None
SNAP00000007442 2/11 Cross Hyb Matching Probes None
GENEFINDER00000007452 1/11 Cross Hyb Matching Probes None
GENEFINDER00000007459 2/11 Cross Hyb Matching Probes None
SNAP00000011265 1/11 Cross Hyb Matching Probes None
GENEFINDER00000011290 1/11 Cross Hyb Matching Probes None
SNAP00000023063 2/11 Cross Hyb Matching Probes None
GENEFINDER00000023069 2/11 Cross Hyb Matching Probes None
SNAP00000025313 1/11 Cross Hyb Matching Probes None
GENEFINDER00000025319 1/11 Cross Hyb Matching Probes None
SNAP00000039737 1/11 Cross Hyb Matching Probes None
SNAP00000041958 1/11 Cross Hyb Matching Probes None
GENEFINDER00000041968 1/11 Cross Hyb Matching Probes None
SNAP00000039146 1/11 Cross Hyb Matching Probes None
GENEFINDER00000039152 1/11 Cross Hyb Matching Probes None
SNAP00000033176 2/11 Cross Hyb Matching Probes None
GENEFINDER00000033181 2/11 Cross Hyb Matching Probes None
T28F2.8 1/11 Cross Hyb Matching Probes A 
F22D6.10 1/11 Cross Hyb Matching Probes A 
ZK265.2 1/11 Cross Hyb Matching Probes A 
C01B12.1 2/11 Cross Hyb Matching Probes A 
F38A3.1 1/11 Cross Hyb Matching Probes A 
T21B4.2 1/11 Cross Hyb Matching Probes A 
F11H8.3 1/11 Cross Hyb Matching Probes A 
C29E4.1 1/11 Cross Hyb Matching Probes A 
K04H4.1a 1/11 Cross Hyb Matching Probes A 
Y41C4A.16 1/11 Cross Hyb Matching Probes A 
ZK1010.7 1/11 Cross Hyb Matching Probes A 
F14F7.1.2 1/11 Cross Hyb Matching Probes A 
F14F7.1.1 1/11 Cross Hyb Matching Probes A 
F14F7.1.3 1/11 Cross Hyb Matching Probes A 
F29C4.8 1/11 Cross Hyb Matching Probes A 
K02D7.3 1/11 Cross Hyb Matching Probes A 
C18H7.3 1/11 Cross Hyb Matching Probes A 
F56B3.1 1/11 Cross Hyb Matching Probes A 
D2024.8 1/11 Cross Hyb Matching Probes A 
C46A5.3 1/11 Cross Hyb Matching Probes A 
C53B4.5 1/11 Cross Hyb Matching Probes A 
C24F3.6 1/11 Cross Hyb Matching Probes None
F08G5.4 1/11 Cross Hyb Matching Probes A 
Y51H4A.9 1/11 Cross Hyb Matching Probes A 
F41F3.4 2/11 Cross Hyb Matching Probes A 
F26F12.1 1/11 Cross Hyb Matching Probes A 
ZC513.8 1/11 Cross Hyb Matching Probes A 
T06E4.6 1/11 Cross Hyb Matching Probes A 
T06E4.4 2/11 Cross Hyb Matching Probes A 
F15H10.2 1/11 Cross Hyb Matching Probes A 
F15H10.1.2 1/11 Cross Hyb Matching Probes A 
F15H10.1.1 1/11 Cross Hyb Matching Probes A 
ZK863.2 1/11 Cross Hyb Matching Probes A 
C50B6.4 1/11 Cross Hyb Matching Probes A 
F02D10.1 1/11 Cross Hyb Matching Probes A 
H06A10.2 2/11 Cross Hyb Matching Probes None
F01G12.5b.1 1/11 Cross Hyb Matching Probes A 
F01G12.5b.2 1/11 Cross Hyb Matching Probes A 
F01G12.5a 1/11 Cross Hyb Matching Probes A 
Genomic Alignment of Consensus/Exemplar Sequence
Assembly Wormbase March 2004
Alignment(s)
Position Identity Coverage Cytoband
chrV:12355608-12356668(+) 76.16 100.0
Public Domain and Genome References
Gene Title collagen
Gene Symbol sqt-3
Ensembl F23H12.4
Entrez Gene 179693 Entrez gene
SwissProt P08124 EMBL-EBI
WormBase CE05707 Wormbase
Functional Annotations
Gene Ontology
GO Biological Process (view graph)
ID Description Evidence Links
6817 phosphate transport inferred from electronic annotation QuickGO AmiGO
GO Cellular Component (view graph)
ID Description Evidence Links
5737 cytoplasm inferred from electronic annotation QuickGO AmiGO
GO Molecular Function (view graph)
ID Description Evidence Links
42302 structural constituent of cuticle inferred from electronic annotation QuickGO AmiGO
Protein Similarities
Method ID Description E-Value
blast CAA98942 Hypothetical protein F23H12.4 [Caenorhabditis elegans] ref|NP_506095.1| F23H12.4 [Caenorhabditis elegans] pir||T21314 hypothetical protein F23H12.4 - Caenorhabditis elegans 1.0E-54
blast CAE75463 Hypothetical protein CBG23461 [Caenorhabditis briggsae] 1.0E-53
blast P08124 Cuticle collagen 1 precursor (Squat-3 protein) (Dumpy-15 protein) emb|CAA23463.1| unnamed protein product [Caenorhabditis elegans] gb|AAA27988.1| collagen 7.0E-50
Protein Domains
Database ID Description E-Value
Pfam IPR002486 EMBL-EBI Nematode cuticle collagen, N-terminal 6.9E-9
Pfam IPR008160 EMBL-EBI Collagen triple helix repeat 0.0015
Pfam IPR008160 EMBL-EBI Collagen triple helix repeat 2.7E-9
Pfam IPR008160 EMBL-EBI Collagen triple helix repeat 7.2E-13
Pfam IPR008160 EMBL-EBI Collagen triple helix repeat 0.0015
Pfam IPR008160 EMBL-EBI Collagen triple helix repeat 2.7E-9
Pfam IPR008160 EMBL-EBI Collagen triple helix repeat 7.2E-13
Trans Membrane
ID Number Of Domains Domain Boundaries
NP_506095.1 1 12-34
F23H12.4.2 1 12-34
F23H12.4.1 1 12-34
GENEFINDER00000020025 1 12-34
Sequence
Target Sequence 
>C. ELEGANS:172820_X_AT
ctccaatgcgagggatgctgccttccaggaccaccaggaccagctggagccccaggaaag
ccaggaaagccaggacgtccaggagcaccaggaactccaggaaccccaggaaagccacca
gttgccccatgtgagccaactactccaccaccatgcaagccatgcccacaaggaccacca
ggaccaccaggaccaccaggagcaccaggagacccgggagaggctggaaccccaggacgc
ccagggaccgatgccgccccaggatccccaggaccacgtggaccaccaggaccagctgga
gaggccggagccccaggaccagccggagagccaggaaccccagctatttccgagccactc
accccaggagcaccaggagagccaggagactctggaccaccaggaccaccaggaccacca
ggagcaccaggaaacgacggaccgccaggaccaccaggaccaaagggagccccaggacca
gacggaccaccaggagtcgacggacaatccggaccaccaggaccaccaggaccagctgga
accccaggagagaagggaatctgtccaaagtattgcgctctcg

BLASTn GenBank NR
Probe Info
Probe Sequence(5'-3') Probe X Probe Y Probe Interrogation
Position 		Strandedness
CTCCAATGCGAGGGATGCTGCCTTC 604 235 298 Antisense
TCCAGGACCACCAGGACCAGCTGGA 458 587 321 Antisense
GGAGCCCCAGGAAAGCCAGGAAAGC 405 521 343 Antisense
GGAGCACCAGGAACTCCAGGAACCC 617 519 379 Antisense
GGACCACCAGGACCAGCTGGAGAGG 372 523 577 Antisense
GAGAGCCAGGAGACTCTGGACCACC 350 395 674 Antisense
AGGAGCACCAGGAAACGACGGACCG 666 55 717 Antisense
CAGGACCACCAGGACCAAAGGGAGC 162 207 743 Antisense
GGAGTCGACGGACAATCCGGACCAC 286 495 790 Antisense
AGGACCACCAGGACCAGCTGGAACC 38 57 816 Antisense
ATCTGTCCAAAGTATTGCGCTCTCG 157 35 856 Antisense
Sequence Source Affymetrix Proprietary Database