[Home] | [Total List]

[172815_x_at] Major sperm protein (msp-142)

Description K05F1.2 /REP_DB=WormBase Gene ID /WP=CE02806 /GEN=msp-142 /SUBMIT=ST.LOUIS /CHR=2 /FEA=Sanger Annotation /DEF=Major sperm protein (msp-142)
Cluster 6grp_total > 99      4grp_total > 05      6grp_cgc > 79      6grp_cgc_sub > Da      6grp_total_sub > Increase      6grp_rule_based > S6      

Scale
G range Absolute graph Relative graph Expression Table Dauer Comp.
4 212
1 2 3 4 range
A 112
(-1.3)
A 		50.6
(-3)
A 		82.8
(-2.1)
A 		262.5
(3)
A 		212
B 129
(3)
A 		96.5
(-1.5)
A 		85.5
(-3)
A 		86.4
(-2.9)
A 		44
C 142.1
(-1)
A 		116.7
(-1.8)
A 		81.7
(-3)
A 		260.7
(3)
A 		179
avr 127.7
(-0.8) 		87.9
(-2.8) 		83.3
(-3) 		203.2
(3) 		120

1 : 1 state (S1, L1)
2 : dauer (ST, LT)
6 2760
1 2 3 4 5 6 range
A 22.2
(-3)
A 		69.2
(-2.9)
A 		170.9
(-2.7)
A 		275
(-2.5)
P 		1819.5
(0.9)
P 		2781.9
(3)
P 		2760
B 93.3
(-2.9)
A 		93.5
(-2.9)
A 		59
(-3)
A 		252
(-2.4)
P 		1984.5
(2.7)
P 		2098.7
(3)
P 		2040
C 92.7
(-3)
A 		149.4
(-2.9)
A 		134.1
(-2.9)
A 		269.4
(-2.5)
P 		2373.2
(3)
P 		2235.1
(2.6)
P 		2281
avr 69.4
(-3) 		104
(-2.9) 		121.3
(-2.9) 		265.5
(-2.5) 		2059.1
(2.2) 		2371.9
(3) 		2303
No Scale
G range Absolute graph Relative graph Expression Table Dauer Comp.
4 36
1 2 3 4 range
A 40.8
(3)
A 		11
(-3)
A 		21.7
(-0.8)
A 		38.4
(2.5)
A 		30
B 41.1
(3)
A 		23.8
(-1.6)
A 		19.8
(-2.6)
A 		18.4
(-3)
A 		23
C 47
(3)
A 		33.6
(-1.3)
A 		28.5
(-3)
A 		44
(2)
A 		19
avr 43
(3) 		22.8
(-3) 		23.3
(-2.9) 		33.6
(0.2) 		20

1 : 1 state (S1, L1)
2 : dauer (ST, LT)
6 802
1 2 3 4 5 6 range
A 4.1
(-3)
A 		24.6
(-2.8)
A 		37.2
(-2.7)
A 		69.8
(-2.4)
P 		549
(1.9)
P 		677.3
(3)
P 		673
B 32.5
(-2.9)
A 		31.1
(-2.9)
A 		14.3
(-3)
A 		66.8
(-2.6)
P 		806.3
(3)
P 		782.6
(2.8)
P 		792
C 34.3
(-3)
A 		45.6
(-2.9)
A 		34.1
(-3)
A 		54.2
(-2.8)
P 		767.9
(3)
P 		748.2
(2.8)
P 		734
avr 23.6
(-3) 		33.8
(-2.9) 		28.5
(-3) 		63.6
(-2.7) 		707.7
(2.8) 		736
(3) 		712
NetAffx Links Cluster Members
Consensus/Exemplar
Group Members
GeneChip Array Information
Probe Set ID 172815_x_at
GeneChip Array C. elegans Genome Array
Organism Common Name Nematode
Probe Design Information
Transcript ID(Array Design) affy.Ce.5561
Sequence Type Exemplar sequence
Representative Public ID K05F1.2 NCBI
Target Description K05F1.2 /REP_DB=WormBase Gene ID /WP=CE02806 /GEN=msp-142 /SUBMIT=ST.LOUIS /CHR=2 /FEA=Sanger Annotation /DEF=Major sperm protein (msp-142)
Cluster Evidence This cluster is supported by a Sanger Annotation.
Annotation Method Description
Annotation Description This probe set was annotated using the Matching Probes based pipeline to a RefSeq identifier using 1 transcript(s).
Annotation Grade This is a grade A annotation.
Annotation Transcript Cluster (# of Matching Probes) NM_062743(11)
Transcript Assignments
Representative
Transcript		 Description Matching Probes Related Probesets by Grade
NM_062743 NCBI Caenorhabditis elegans Major Sperm Protein family member (msp-142) (msp-142) mRNA, complete cds. 11/11 None
SNAP00000031245 ENSEMBL cdna:SNAP chromosome:CEL140:II:5797892:5798275:1 11/11 None
GENEFINDER00000031258 ENSEMBL cdna:GeneFinder chromosome:CEL140:II:5797892:5798275:1 11/11 None
K05F1.2 ENSEMBL cdna:known chromosome:CEL140:II:5797892:5798275:1 gene:K05F1.2 11/11 None
Annotation Notes
Cross Hybridizing mRNA Matched Probes Nature of Assignment Related Probesets by Grade
NM_068370 1/11 Cross Hyb Matching Probes A 
NM_068310 2/11 Cross Hyb Matching Probes A 
NM_068312 1/11 Cross Hyb Matching Probes A 
NM_068313 1/11 Cross Hyb Matching Probes A 
NM_069063 1/11 Cross Hyb Matching Probes A 
NM_062558 1/11 Cross Hyb Matching Probes A 
NM_062559 1/11 Cross Hyb Matching Probes None
NM_068351 1/11 Cross Hyb Matching Probes A 
NM_068354 1/11 Cross Hyb Matching Probes A 
NM_068359 1/11 Cross Hyb Matching Probes A 
NM_068377 1/11 Cross Hyb Matching Probes A 
NM_068379 1/11 Cross Hyb Matching Probes A 
NM_062742 3/11 Cross Hyb Matching Probes A 
NM_062748 5/11 Cross Hyb Matching Probes A 
NM_062753 3/11 Cross Hyb Matching Probes A 
NM_069321 1/11 Cross Hyb Matching Probes A 
NM_069339 1/11 Cross Hyb Matching Probes A 
NM_069341 1/11 Cross Hyb Matching Probes A 
NM_069358 1/11 Cross Hyb Matching Probes A 
NM_069359 1/11 Cross Hyb Matching Probes A 
NM_069361 1/11 Cross Hyb Matching Probes A 
NM_069380 1/11 Cross Hyb Matching Probes A 
NM_062764 2/11 Cross Hyb Matching Probes A 
NM_068372 1/11 Cross Hyb Matching Probes A 
SNAP00000024816 1/11 Cross Hyb Matching Probes None
GENEFINDER00000024829 1/11 Cross Hyb Matching Probes None
SNAP00000019951 1/11 Cross Hyb Matching Probes None
GENEFINDER00000019958 1/11 Cross Hyb Matching Probes None
GENEFINDER00000019959 1/11 Cross Hyb Matching Probes None
SNAP00000031244 3/11 Cross Hyb Matching Probes None
GENEFINDER00000031253 3/11 Cross Hyb Matching Probes None
SNAP00000041369 5/11 Cross Hyb Matching Probes None
SNAP00000041374 3/11 Cross Hyb Matching Probes None
SNAP00000041384 2/11 Cross Hyb Matching Probes None
GENEFINDER00000041386 3/11 Cross Hyb Matching Probes None
GENEFINDER00000041391 2/11 Cross Hyb Matching Probes None
GENEFINDER00000041398 5/11 Cross Hyb Matching Probes None
SNAP00000002639 1/11 Cross Hyb Matching Probes None
SNAP00000002641 1/11 Cross Hyb Matching Probes None
GENEFINDER00000002656 1/11 Cross Hyb Matching Probes None
GENEFINDER00000002661 1/11 Cross Hyb Matching Probes None
SNAP00000004243 1/11 Cross Hyb Matching Probes None
SNAP00000004244 1/11 Cross Hyb Matching Probes None
SNAP00000004246 1/11 Cross Hyb Matching Probes None
GENEFINDER00000004263 1/11 Cross Hyb Matching Probes None
GENEFINDER00000004265 1/11 Cross Hyb Matching Probes None
GENEFINDER00000004273 1/11 Cross Hyb Matching Probes None
SNAP00000006004 1/11 Cross Hyb Matching Probes None
SNAP00000006006 1/11 Cross Hyb Matching Probes None
SNAP00000006011 1/11 Cross Hyb Matching Probes None
SNAP00000006013 1/11 Cross Hyb Matching Probes None
SNAP00000006015 1/11 Cross Hyb Matching Probes None
GENEFINDER00000006018 1/11 Cross Hyb Matching Probes None
GENEFINDER00000006020 1/11 Cross Hyb Matching Probes None
GENEFINDER00000006021 1/11 Cross Hyb Matching Probes None
GENEFINDER00000006023 1/11 Cross Hyb Matching Probes None
GENEFINDER00000006024 1/11 Cross Hyb Matching Probes None
SNAP00000007231 2/11 Cross Hyb Matching Probes None
GENEFINDER00000007236 2/11 Cross Hyb Matching Probes None
SNAP00000023386 1/11 Cross Hyb Matching Probes None
GENEFINDER00000023395 1/11 Cross Hyb Matching Probes None
SNAP00000029404 1/11 Cross Hyb Matching Probes None
SNAP00000029405 1/11 Cross Hyb Matching Probes None
GENEFINDER00000029413 1/11 Cross Hyb Matching Probes None
GENEFINDER00000029416 1/11 Cross Hyb Matching Probes None
SNAP00000029847 1/11 Cross Hyb Matching Probes None
GENEFINDER00000029849 1/11 Cross Hyb Matching Probes None
SNAP00000034129 1/11 Cross Hyb Matching Probes None
SNAP00000034134 1/11 Cross Hyb Matching Probes None
GENEFINDER00000034137 1/11 Cross Hyb Matching Probes None
GENEFINDER00000034140 1/11 Cross Hyb Matching Probes None
SNAP00000041533 1/11 Cross Hyb Matching Probes None
GENEFINDER00000041543 1/11 Cross Hyb Matching Probes None
SNAP00000043472 1/11 Cross Hyb Matching Probes None
SNAP00000043475 1/11 Cross Hyb Matching Probes None
GENEFINDER00000043484 1/11 Cross Hyb Matching Probes None
GENEFINDER00000043489 1/11 Cross Hyb Matching Probes None
F58A6.8 1/11 Cross Hyb Matching Probes A 
K05F1.7 3/11 Cross Hyb Matching Probes A 
ZK1248.6 5/11 Cross Hyb Matching Probes A 
ZK1248.4 3/11 Cross Hyb Matching Probes A 
ZK1248.17 2/11 Cross Hyb Matching Probes A 
C09B9.6 2/11 Cross Hyb Matching Probes A 
R13H9.2 1/11 Cross Hyb Matching Probes A 
R13H9.4 1/11 Cross Hyb Matching Probes A 
Y59E9AR.7 1/11 Cross Hyb Matching Probes A 
Y59E9AR.1 1/11 Cross Hyb Matching Probes A 
F36H12.7 1/11 Cross Hyb Matching Probes A 
F36H12.6 1/11 Cross Hyb Matching Probes None
ZK354.5 1/11 Cross Hyb Matching Probes A 
ZK354.4 1/11 Cross Hyb Matching Probes A 
ZK354.10 1/11 Cross Hyb Matching Probes None
ZK354.11 1/11 Cross Hyb Matching Probes A 
ZK354.1 1/11 Cross Hyb Matching Probes A 
Y59H11AM.1 1/11 Cross Hyb Matching Probes A 
ZK1251.6 1/11 Cross Hyb Matching Probes A 
T13F2.10 1/11 Cross Hyb Matching Probes A 
T13F2.11 1/11 Cross Hyb Matching Probes A 
K07F5.1 1/11 Cross Hyb Matching Probes A 
K07F5.2 1/11 Cross Hyb Matching Probes A 
K07F5.3 1/11 Cross Hyb Matching Probes A 
F32B6.6 1/11 Cross Hyb Matching Probes A 
C04G2.3 1/11 Cross Hyb Matching Probes None
Genomic Alignment of Consensus/Exemplar Sequence
Assembly Wormbase March 2004
Alignment(s)
Position Identity Coverage Cytoband
chrII:5797888-5798272(+) 100.0 100.0
chrIV:5249434-5249954(+) 90.1 90.1
chrII:5797030-5797410(-) 93.49 93.49
chrII:5809910-5810292(-) 93.49 93.49
chrIV:5241257-5313106(-) 91.41 91.41
Public Domain and Genome References
Gene Title Major sperm protein (msp-142)
Gene Symbol msp-142
Ensembl K05F1.2
Entrez Gene 173981 Entrez gene
SwissProt P53017 EMBL-EBI
WormBase CE02806 Wormbase
Functional Annotations
Gene Ontology
GO Molecular Function (view graph)
ID Description Evidence Links
5198 structural molecule activity inferred from electronic annotation QuickGO AmiGO
Protein Similarities
Method ID Description E-Value
blast AAA85761 Major sperm protein protein 50 [Caenorhabditis elegans] emb|CAA94282.1| Hypothetical protein K07F5.1 [Caenorhabditis elegans] gb|AAK85493.1| Major sperm protein protein 53 [Caenorhabditis elegans] gb|AAB42254.1| Major sperm protein protein 51 [Caenorhabditis elegans] gb|AAB42255.1| Major sperm protein protein 113 [Caenorhabditis elegans] gb|AAB42253.1| Major sperm protein protein 59 [Caenorhabditis elegans] gb|AAB42256.1| Major sperm protein protein 65 [Caenorhabditis elegans] gb|AAC71087.1| Major sperm protein protein 64 [Caenorhabditis elegans] gb|AAA68711.1| Major sperm protein protein 142 [Caenorhabditis elegans] gb|AAA96204.1| Major sperm protein protein 45 [Caenorhabditis elegans] gb|AAC26926.1| Major sperm protein protein 19 [Caenorhabditis elegans] ref|NP_500773.1| Major Sperm Protein family member (msp-113) [Caenorhabditis elegans] ref|NP_500771.1| Major Sperm Protein family member (msp-51) [Caenorhabditis elegans] ref|NP_501759.1| Major Sperm Protein family member (msp-81) [Caenorhabditis elegans] ref|NP_500780.1| Major Sperm Protein family member (msp-65) [Caenorhabditis elegans] ref|NP_500778.1| Major Sperm Protein family member (msp-59) [Caenorhabditis elegans] ref|NP_500760.1| Major Sperm Protein family member (msp-19) [Caenorhabditis elegans] ref|NP_500714.1| Major Sperm Protein family member (msp-53) [Caenorhabditis elegans] ref|NP_495149.1| Major Sperm Protein family member (msp-64) [Caenorhabditis elegans] ref|NP_495144.1| Major Sperm Protein family member (msp-142) [Caenorhabditis elegans] ref|NP_494972.1| Major Sperm Protein family member (msp-50) [Caenorhabditis elegans] ref|NP_494959.1| Major Sperm Protein family member (msp-45) [Caenorhabditis elegans] ref|NP_494898.1| Major Sperm Protein family member (msp-31) [Caenorhabditis elegans] ref|NP_494865.1| Major Sperm Protein family member (msp-40) [Caenorhabditis elegans] gb|AAK31477.1| Major sperm protein protein 40 [Caenorhabditis elegans] gb|AAA83175.1| Major sperm protein protein 31 [Caenorhabditis elegans] sp|P53017|MSP19_CAEEL Major sperm protein 19/31/40/45/50/51/53/59/61/65/81/113/142 (MSP) 1.0E-71
blast CAB03362 Hypothetical protein T13F2.11 [Caenorhabditis elegans] ref|NP_501742.1| Major Sperm Protein family member (msp-78) [Caenorhabditis elegans] sp|Q94053|MSP78_CAEEL Major sperm protein 78 (MSP) 2.0E-71
blast AAK68539 Hypothetical protein Y59H11AM.1 [Caenorhabditis elegans] ref|NP_501464.1| Y59H11AM.1 [Caenorhabditis elegans] 3.0E-71
Protein Domains
Database ID Description E-Value
Pfam IPR000535 EMBL-EBI Major sperm protein (MSP) domain 4.7E-35
Sequence
Target Sequence 
>C. ELEGANS:172815_X_AT
catccagacccagccgggtacaaagattgtcttcaatgctccgtacgacgacaagcacac
gtatcacatcaaagtgatcaattcgtcggcacgccgtattggatacggtatcaagaccac
caacatgaagagacttggagttgatccaccatgtggagttctcgacccaaaggaagcagt
gcttctggcagtttcctgcgatgcatttgcttttggacaagaagacaccaacaacgaccg
tatcaccgtcgaatggaccaacaccccggatggagctgccaagcagttccgccgcgagtg
gttccagggagatgg

BLASTn GenBank NR
Probe Info
Probe Sequence(5'-3') Probe X Probe Y Probe Interrogation
Position 		Strandedness
CATCCAGACCCAGCCGGGTACAAAG 521 209 39 Antisense
TGTCTTCAATGCTCCGTACGACGAC 252 467 66 Antisense
GACAAGCACACGTATCACATCAAAG 460 365 88 Antisense
GATCAATTCGTCGGCACGCCGTATT 241 421 114 Antisense
ACCATGTGGAGTTCTCGACCCAAAG 496 83 186 Antisense
AGCAGTGCTTCTGGCAGTTTCCTGC 146 77 213 Antisense
TCCTGCGATGCATTTGCTTTTGGAC 411 593 232 Antisense
AGAAGACACCAACAACGACCGTATC 377 71 258 Antisense
GACCGTATCACCGTCGAATGGACCA 86 377 274 Antisense
GGATGGAGCTGCCAAGCAGTTCCGC 404 515 306 Antisense
GCCGCGAGTGGTTCCAGGGAGATGG 635 285 329 Antisense
Sequence Source Affymetrix Proprietary Database