|
|
Cluster Members Consensus/Exemplar Group Members |
GeneChip Array Information |
|
172788_x_at |
|
C. elegans Genome Array |
|
Nematode |
Probe Design Information |
|
affy.Ce.8710
|
|
Exemplar sequence
|
|
F22B3.2 NCBI
|
|
F22B3.2 /REP_DB=WormBase Gene ID /WP=CE03253 /TR=SW:P08898 /GB=CAA92733.1 /SUBMIT=HINXTON /CHR=4 /FEA=Sanger Annotation /DEF=histone H3
|
This cluster is supported by a Sanger Annotation. |
Annotation Method Description |
|
This probe set was annotated using the Matching Probes based pipeline to a RefSeq identifier using 1 transcript(s). |
|
This is a grade A annotation. |
|
NM_069752(11), NM_069733(10), NM_069737(10) |
|
|
|
|
|
NM_069752 NCBI |
Caenorhabditis elegans HIStone family member (his-63) (his-63) mRNA, complete cds. |
11/11 |
A |
NM_069733 NCBI |
Caenorhabditis elegans HIStone family member (his-45) (his-45) mRNA, complete cds. |
10/11 |
A |
NM_069737 NCBI |
Caenorhabditis elegans HIStone family member (his-55) (his-55) mRNA, complete cds. |
10/11 |
A |
SNAP00000002621 ENSEMBL |
cdna:SNAP chromosome:CEL140:IV:11337824:11338234:-1 |
10/11 |
None |
GENEFINDER00000002632 ENSEMBL |
cdna:GeneFinder chromosome:CEL140:IV:11337824:11338234:-1 |
10/11 |
None |
SNAP00000028586 ENSEMBL |
cdna:SNAP chromosome:CEL140:IV:11406422:11406832:-1 |
11/11 |
None |
GENEFINDER00000028598 ENSEMBL |
cdna:GeneFinder chromosome:CEL140:IV:11406422:11406832:-1 |
11/11 |
None |
SNAP00000035840 ENSEMBL |
cdna:SNAP chromosome:CEL140:IV:11326559:11326969:1 |
10/11 |
None |
GENEFINDER00000035856 ENSEMBL |
cdna:GeneFinder chromosome:CEL140:IV:11326559:11326969:1 |
10/11 |
None |
B0035.10 ENSEMBL |
cdna:known chromosome:CEL140:IV:11326559:11326969:1 gene:B0035.10 |
10/11 |
A |
F54E12.1 ENSEMBL |
cdna:known chromosome:CEL140:IV:11337824:11338234:-1 gene:F54E12.1 |
10/11 |
A |
F22B3.2 ENSEMBL |
cdna:known chromosome:CEL140:IV:11406422:11406832:-1 gene:F22B3.2 |
11/11 |
A | |
NM_068803 |
2/11 |
Cross Hyb Matching Probes |
A |
NM_065410 |
2/11 |
Cross Hyb Matching Probes |
A |
NM_072896 |
1/11 |
Cross Hyb Matching Probes |
A B |
NM_072875 |
1/11 |
Cross Hyb Matching Probes |
A B |
NM_069006 |
2/11 |
Cross Hyb Matching Probes |
A B |
NM_072891 |
1/11 |
Cross Hyb Matching Probes |
A B |
SNAP00000010986 |
6/11 |
Cross Hyb Matching Probes |
None |
GENEFINDER00000010992 |
6/11 |
Cross Hyb Matching Probes |
None |
SNAP00000016640 |
2/11 |
Cross Hyb Matching Probes |
None |
GENEFINDER00000016651 |
2/11 |
Cross Hyb Matching Probes |
None |
SNAP00000000480 |
2/11 |
Cross Hyb Matching Probes |
None |
GENEFINDER00000000500 |
2/11 |
Cross Hyb Matching Probes |
None |
SNAP00000005174 |
2/11 |
Cross Hyb Matching Probes |
None |
GENEFINDER00000005184 |
2/11 |
Cross Hyb Matching Probes |
None |
SNAP00000015092 |
1/11 |
Cross Hyb Matching Probes |
None |
GENEFINDER00000015146 |
1/11 |
Cross Hyb Matching Probes |
None |
SNAP00000018183 |
1/11 |
Cross Hyb Matching Probes |
None |
SNAP00000018188 |
1/11 |
Cross Hyb Matching Probes |
None |
GENEFINDER00000018196 |
1/11 |
Cross Hyb Matching Probes |
None |
GENEFINDER00000018198 |
1/11 |
Cross Hyb Matching Probes |
None |
W09H1.2 |
6/11 |
Cross Hyb Matching Probes |
A |
E03A3.3 |
2/11 |
Cross Hyb Matching Probes |
A |
F55G1.2 |
2/11 |
Cross Hyb Matching Probes |
A |
F17E9.10 |
2/11 |
Cross Hyb Matching Probes |
A B |
F07B7.5 |
1/11 |
Cross Hyb Matching Probes |
A B |
K06C4.13 |
1/11 |
Cross Hyb Matching Probes |
A B |
K06C4.5 |
1/11 |
Cross Hyb Matching Probes |
A B | |
Genomic Alignment of Consensus/Exemplar Sequence |
|
Wormbase March 2004 |
|
|
|
|
|
chrII:13823541-13823952(+) |
92.7 |
92.7 |
|
chrII:13820103-13820514(+) |
92.7 |
92.7 |
|
chrIV:11326564-11326975(+) |
98.78 |
98.78 |
|
chrIV:7488238-7488649(+) |
95.38 |
95.38 |
|
chrIV:8334292-8334703(+) |
93.67 |
93.67 |
|
chrII:13824742-13825153(-) |
92.7 |
92.7 |
|
chrII:13828180-13828591(-) |
92.21 |
92.21 |
|
chrIV:11406427-11406838(-) |
100.0 |
100.0 |
|
chrIV:11337829-11338240(-) |
98.78 |
98.78 |
| |
Public Domain and Genome References |
|
histone H3 histone H3 histone H3
|
|
his-45 his-63 his-55
|
|
B0035.10 F54E12.1 F22B3.2
|
|
181821 Entrez gene 184804 Entrez gene 186250 Entrez gene
|
|
P08898 EMBL-EBI
|
|
CE03253 Wormbase CE03253 Wormbase CE03253 Wormbase
|
Functional Annotations |
|
|
|
|
ATH1-121501:252824_AT |
histone H3.2 |
at |
CANINE_2:CFAAFFX.16507.1.S1_AT |
similar to histone 1, H2ai (predicted) |
cfa |
CANINE_2:CFAAFFX.945.1.S1_AT |
similar to histone 1, H2ai (predicted) |
cfa |
CANINE_2:CFAAFFX.945.1.S1_S_AT |
similar to histone 1, H2ai (predicted) |
cfa |
HUGENEFL:M60746_AT |
histone 1, H3e |
hs |
U133_X3P:HS.143522.0.S2_3P_AT |
histone 1, H3e |
hs |
HG-U133A_2:214616_AT |
histone 1, H3e |
hs |
HG-FOCUS:214616_AT |
histone 1, H3e |
hs |
HG-U133_PLUS_2:214616_AT |
histone 1, H3e |
hs |
HG-U133A:214616_AT |
histone 1, H3e |
hs |
HG-U95AV2:35598_AT |
histone 1, H3e |
hs |
HU35KSUBD:RC_AA400914_AT |
Histone 1, H3e |
hs |
MG-U74AV2:93024_AT |
histone 1, H3g |
mm |
MOE430A:1460314_S_AT |
histone 1, H3g |
mm |
MOUSE430_2:1460314_S_AT |
histone 1, H3g |
mm |
MOUSE430A_2:1460314_S_AT |
histone 1, H3g |
mm |
MU11KSUBA:M32460_AT |
histone 1, H3g |
mm |
MG-U74AV2:96416_F_AT |
histone 1, H3g |
mm |
MG-U74AV2:93023_F_AT |
histone 1, H3g |
mm |
MOE430A:1460314_S_AT |
histone 1, H3h |
mm |
MOUSE430_2:1460314_S_AT |
histone 1, H3h |
mm |
MOUSE430A_2:1460314_S_AT |
histone 1, H3h |
mm |
MG-U74AV2:94756_AT |
histone 1, H3h |
mm |
MOUSE430A_2:1427864_AT |
histone 1, H3h |
mm |
MOE430A:1427864_AT |
histone 1, H3h |
mm |
MOUSE430_2:1427864_AT |
histone 1, H3h |
mm |
MU11KSUBA:M32461_S_AT |
histone 1, H3h |
mm |
MG-U74AV2:96416_F_AT |
histone 1, H3h |
mm |
MG-U74AV2:93023_F_AT |
histone 1, H3h |
mm |
MOE430A:1431231_AT |
histone 1, H3h |
mm |
MOUSE430A_2:1431231_AT |
histone 1, H3h |
mm |
MOUSE430_2:1431231_AT |
histone 1, H3h |
mm |
MOE430A:1460314_S_AT |
histone 1, H3i |
mm |
MOUSE430_2:1460314_S_AT |
histone 1, H3i |
mm |
MOUSE430A_2:1460314_S_AT |
histone 1, H3i |
mm |
MG-U74AV2:94756_AT |
histone 1, H3i |
mm |
MOUSE430A_2:1427864_AT |
histone 1, H3i |
mm |
MOE430A:1427864_AT |
histone 1, H3i |
mm |
MOUSE430_2:1427864_AT |
histone 1, H3i |
mm |
MU11KSUBA:M32461_S_AT |
histone 1, H3i |
mm |
MG-U74AV2:96416_F_AT |
histone 1, H3i |
mm |
MG-U74AV2:93023_F_AT |
histone 1, H3i |
mm |
MOE430A:1431231_AT |
histone 1, H3i |
mm |
MOUSE430A_2:1431231_AT |
histone 1, H3i |
mm |
MOUSE430_2:1431231_AT |
histone 1, H3i |
mm |
MOE430A:1460314_S_AT |
histone 1, H3a |
mm |
MOUSE430_2:1460314_S_AT |
histone 1, H3a |
mm |
MOUSE430A_2:1460314_S_AT |
histone 1, H3a |
mm |
MG-U74AV2:93023_F_AT |
histone 1, H3a |
mm |
MOUSE430_2:1443475_AT |
Histone 1, H3i (Hist1h3i), mRNA |
mm |
MOE430B:1443475_AT |
Histone 1, H3i (Hist1h3i), mRNA |
mm |
MU19KSUBB:TC34010_AT |
Histone 1, H3i (Hist1h3i), mRNA |
mm |
RG-U34A:U95113CDS_F_AT |
Histone H2a |
rn |
RG-U34C:AA944116_F_AT |
Histone H2a |
rn |
RAE230A:1371279_AT |
Histone H2a |
rn |
RAT230_2:1371279_AT |
Histone H2a |
rn | |
|
|
|
|
|
6334 |
nucleosome assembly |
inferred from electronic annotation |
QuickGO AmiGO |
7001 |
chromosome organization and biogenesis (sensu Eukaryota) |
inferred from electronic annotation |
QuickGO AmiGO |
|
|
|
|
786 |
nucleosome |
inferred from electronic annotation |
QuickGO AmiGO |
5634 |
nucleus |
inferred from electronic annotation |
QuickGO AmiGO |
|
|
|
|
3677 |
DNA binding |
inferred from electronic annotation |
QuickGO AmiGO | |
|
|
|
|
|
blast |
CAB05834 |
Hypothetical protein ZK131.7 [Caenorhabditis elegans] emb|CAB05833.1| Hypothetical protein ZK131.3 [Caenorhabditis elegans] emb|CAB05831.1| Hypothetical protein ZK131.2 [Caenorhabditis elegans] emb|CAA97411.1| Hypothetical protein B0035.10 [Caenorhabditis elegans] emb|CAA92733.1| Hypothetical protein F22B3.2 [Caenorhabditis elegans] emb|CAB07653.1| Hypothetical protein T10C6.13 [Caenorhabditis elegans] emb|CAB05209.1| Hypothetical protein F54E12.1 [Caenorhabditis elegans] emb|CAB04057.1| Hypothetical protein F08G2.3 [Caenorhabditis elegans] gb|AAC05102.1| Histone protein 32 [Caenorhabditis elegans] gb|AAK84514.1| Histone protein 49 [Caenorhabditis elegans] gb|AAF98226.1| Histone protein 17 [Caenorhabditis elegans] gb|AAF98231.1| Histone protein 27 [Caenorhabditis elegans] emb|CAA33644.1| Histone protein [Caenorhabditis elegans] gb|AAB00650.1| Histone protein 59 [Caenorhabditis elegans] gb|AAC48033.1| Histone protein 6 [Caenorhabditis elegans] ref|NP_505292.1| HIStone family member (his-27) [Caenorhabditis elegans] ref|NP_505297.1| HIStone family member (his-17) [Caenorhabditis elegans] ref|NP_496890.1| HIStone family member (his-13) [Caenorhabditis elegans] ref|NP_505199.1| HIStone family member (his-6) [Caenorhabditis elegans] ref|NP_501204.1| F55G1.2 [Caenorhabditis elegans] ref|NP_502138.1| HIStone family member (his-55) [Caenorhabditis elegans] ref|NP_502153.1| HIStone family member (his-63) [Caenorhabditis elegans] ref|NP_496899.1| HIStone family member (his-42) [Caenorhabditis elegans] ref|NP_505276.1| HIStone family member (his-49) [Caenorhabditis elegans] ref|NP_502134.1| HIStone family member (his-45) [Caenorhabditis elegans] ref|NP_507033.1| HIStone family member (his-2) [Caenorhabditis elegans] ref|NP_501407.1| HIStone family member (his-32) [Caenorhabditis elegans] ref|NP_496895.1| HIStone family member (his-25) [Caenorhabditis elegans] ref|NP_496894.1| HIStone family member (his-9) [Caenorhabditis elegans] gb|AAG50235.1| histone H3 [Caenorhabditis elegans] pir||HSKW3 histone H3 - Caenorhabditis elegans |
5.0E-70 | |
|
|
|
|
|
Pfam |
IPR007125 EMBL-EBI |
Histone core |
1.6E-29 | |
Sequence |
|
>C. ELEGANS:172788_X_AT
aagcaattggccaccaaagctgcccgcaaatcggctccagcttccggaggagtcaagaaa
ccacatcgttatcgcccaggaaccgtcgctcttcgtgagatcagacgttaccagaaatcc
actgaacttctcatccgcagagcaccattccagcgccttgttcgtgagattgctcaggat
ttcaagaccgatcttcgattccaatcttccgctgtcatggctcttcaggaggctgccgag
gcttaccttgtcggactcttcgaggacaccaacttgtgtgccatccacgctaagcgagtc
accatcatgccaaaggat
BLASTn GenBank NR |
|
|
|
|
|
|
AAGCAATTGGCCACCAAAGCTGCCC |
119 |
151 |
67 |
Antisense |
CAAGAAACCACATCGTTATCGCCCA |
277 |
185 |
120 |
Antisense |
GTCGCTCTTCGTGAGATCAGACGTT |
423 |
475 |
151 |
Antisense |
AGAAATCCACTGAACTTCTCATCCG |
284 |
73 |
179 |
Antisense |
TCCAGCGCCTTGTTCGTGAGATTGC |
94 |
587 |
215 |
Antisense |
AAGACCGATCTTCGATTCCAATCTT |
707 |
153 |
250 |
Antisense |
TTCAGGAGGCTGCCGAGGCTTACCT |
559 |
683 |
290 |
Antisense |
TTACCTTGTCGGACTCTTCGAGGAC |
551 |
681 |
309 |
Antisense |
GAGGACACCAACTTGTGTGCCATCC |
303 |
405 |
328 |
Antisense |
GTGCCATCCACGCTAAGCGAGTCAC |
146 |
479 |
344 |
Antisense |
GCGAGTCACCATCATGCCAAAGGAT |
186 |
291 |
360 |
Antisense | |
|
Affymetrix Proprietary Database |