[Home] | [Total List]

[172753_x_at] collagen /// collagen

Description F55C10.3 /REP_DB=WormBase Gene ID /WP=CE11182 /TR=SW:Q21184 /GB=CAA98487.1 /SUBMIT=HINXTON /CHR=5 /FEA=Sanger Annotation /DEF=collagen
Cluster 6grp_highest_10_10 > 24      6grp_high1_10_10 > 42      4grp_highest_8_8 > 17      4grp_high_8_8 > 61      6grp_highest_nonorm > 08      6grp_total > 31      4grp_total > 59      6grp_cgc > 73      6grp_high1_sub > 02_03      6grp_cgc_sub > 02_03      6grp_total_sub > Hat      6grp_rule_based > S3      4grp_rule_based > L3      

Scale
G range Absolute graph Relative graph Expression Table Dauer Comp.
4 29311
1 2 3 4 range
A 19970.8
(0.7)
P 		30314.6
(2.9)
P 		31027.5
(3)
P 		1949.9
(-3)
P 		29078
B 15030.4
(-0.2)
P 		26838.1
(2.3)
P 		30339.4
(3)
P 		1935.6
(-3)
P 		28404
C 16223.3
(0.8)
P 		24637.5
(3)
P 		23887.2
(2.8)
P 		1716.8
(-3)
P 		22921
avr 17074.8
(0.4) 		27263.4
(2.7) 		28418
(3) 		1867.4
(-3) 		26551

1 : 1 state (S1, L1)
2 : dauer (ST, LT)
6 13708
1 2 3 4 5 6 range
A 17520.5
(-2.6)
P 		23306.6
(1.4)
P 		25712.8
(3)
P 		21932.6
(0.4)
P 		17835.6
(-2.4)
P 		16924.4
(-3)
P 		8788
B 21501.5
(3)
P 		20782.2
(2.4)
P 		21571.2
(3)
P 		19358.8
(1.4)
P 		16340.9
(-0.7)
P 		13189.7
(-3)
P 		8382
C 16745.5
(-0.6)
P 		20710.2
(1.5)
P 		23699.8
(3)
P 		18988.6
(0.6)
P 		20558.6
(1.4)
P 		12005.2
(-3)
P 		11695
avr 18589.2
(-0.2) 		21599.7
(1.7) 		23661.3
(3) 		20093.3
(0.8) 		18245
(-0.4) 		14039.8
(-3) 		9622
No Scale
G range Absolute graph Relative graph Expression Table Dauer Comp.
4 8040
1 2 3 4 range
A 7271.4
(2.4)
P 		6580.5
(1.8)
P 		8111.2
(3)
P 		285.4
(-3)
P 		7826
B 4793.1
(1)
P 		6628.4
(2.6)
P 		7030.3
(3)
P 		412.5
(-3)
P 		6618
C 5370.4
(0.8)
P 		7083.4
(2.1)
P 		8325.4
(3)
P 		289.5
(-3)
P 		8036
avr 5811.6
(1.4) 		6764.1
(2.2) 		7822.3
(3) 		329.1
(-3) 		7493

1 : 1 state (S1, L1)
2 : dauer (ST, LT)
6 5059
1 2 3 4 5 6 range
A 3229.8
(-3)
P 		8289
(3)
P 		5599.7
(-0.2)
P 		5562.6
(-0.2)
P 		5382
(-0.4)
P 		4120.6
(-1.9)
P 		5059
B 7481.5
(3)
P 		6917.5
(1.7)
P 		5238.1
(-2.3)
P 		5127.5
(-2.5)
P 		6639.1
(1)
P 		4918.4
(-3)
P 		2563
C 6206.8
(2.1)
P 		6319.3
(2.3)
P 		6032
(1.7)
P 		3818.6
(-3)
P 		6652.5
(3)
P 		4018.9
(-2.6)
P 		2834
avr 5639.4
(-0.3) 		7175.3
(3) 		5623.3
(-0.3) 		4836.2
(-2) 		6224.5
(1) 		4352.6
(-3) 		2823
NetAffx Links Cluster Members
Consensus/Exemplar
Group Members
GeneChip Array Information
Probe Set ID 172753_x_at
GeneChip Array C. elegans Genome Array
Organism Common Name Nematode
Probe Design Information
Transcript ID(Array Design) affy.Ce.13211
Sequence Type Exemplar sequence
Representative Public ID F55C10.3 NCBI
Target Description F55C10.3 /REP_DB=WormBase Gene ID /WP=CE11182 /TR=SW:Q21184 /GB=CAA98487.1 /SUBMIT=HINXTON /CHR=5 /FEA=Sanger Annotation /DEF=collagen
Cluster Evidence This cluster is supported by a Sanger Annotation.
Annotation Method Description
Annotation Description This probe set was annotated using the Matching Probes based pipeline to a RefSeq identifier using 1 transcript(s).
Annotation Grade This is a grade A annotation.
Annotation Transcript Cluster (# of Matching Probes) NM_073485(11), NM_073487(11)
Transcript Assignments
Representative
Transcript		 Description Matching Probes Related Probesets by Grade
NM_073485 NCBI Caenorhabditis elegans F55C10.2 (collagen) mRNA, complete cds. 11/11 A 
NM_073487 NCBI Caenorhabditis elegans F55C10.3 (collagen) mRNA, complete cds. 11/11 A 
SNAP00000017929 ENSEMBL cdna:SNAP chromosome:CEL140:V:11387965:11388931:1 11/11 None
SNAP00000017931 ENSEMBL cdna:SNAP chromosome:CEL140:V:11391478:11392215:-1 11/11 None
GENEFINDER00000017933 ENSEMBL cdna:GeneFinder chromosome:CEL140:V:11387965:11388931:1 11/11 None
F55C10.2 ENSEMBL cdna:known chromosome:CEL140:V:11387948:11388958:1 gene:F55C10.2 11/11 A 
F55C10.3 ENSEMBL cdna:known chromosome:CEL140:V:11391478:11392345:-1 gene:F55C10.3 11/11 A 
Annotation Notes
Cross Hybridizing mRNA Matched Probes Nature of Assignment Related Probesets by Grade
NM_073276 1/11 Cross Hyb Matching Probes A 
NM_073277 1/11 Cross Hyb Matching Probes A 
NM_059685 1/11 Cross Hyb Matching Probes A 
NM_059689 1/11 Cross Hyb Matching Probes A 
NM_063960 1/11 Cross Hyb Matching Probes A 
NM_058687 1/11 Cross Hyb Matching Probes A 
NM_069466 1/11 Cross Hyb Matching Probes A 
NM_066413 1/11 Cross Hyb Matching Probes None
NM_069125 1/11 Cross Hyb Matching Probes A 
NM_069126 1/11 Cross Hyb Matching Probes A 
NM_069896 2/11 Cross Hyb Matching Probes A 
NM_071851 2/11 Cross Hyb Matching Probes A 
NM_072337 1/11 Cross Hyb Matching Probes A 
NM_073512 6/11 Cross Hyb Matching Probes A 
NM_070299 2/11 Cross Hyb Matching Probes A 
NM_073083 1/11 Cross Hyb Matching Probes A 
NM_067299 1/11 Cross Hyb Matching Probes A 
NM_063358 1/11 Cross Hyb Matching Probes A 
NM_058794 1/11 Cross Hyb Matching Probes None
NM_077468 1/11 Cross Hyb Matching Probes A 
NM_077469 1/11 Cross Hyb Matching Probes A 
NM_073899 1/11 Cross Hyb Matching Probes A 
NM_073933 1/11 Cross Hyb Matching Probes A 
NM_069299 1/11 Cross Hyb Matching Probes A 
NM_072335 1/11 Cross Hyb Matching Probes A 
NM_069706 2/11 Cross Hyb Matching Probes A 
NM_068118 2/11 Cross Hyb Matching Probes A 
NM_067737 1/11 Cross Hyb Matching Probes A 
NM_171361 1/11 Cross Hyb Matching Probes None
NM_077559 1/11 Cross Hyb Matching Probes A 
NM_069777 1/11 Cross Hyb Matching Probes A 
NM_063908 1/11 Cross Hyb Matching Probes A 
NM_063909 1/11 Cross Hyb Matching Probes None
NM_073652 1/11 Cross Hyb Matching Probes A 
GENEFINDER00000007975 1/11 Cross Hyb Matching Probes None
SNAP00000007970 1/11 Cross Hyb Matching Probes None
GENEFINDER00000007974 1/11 Cross Hyb Matching Probes None
SNAP00000038907 1/11 Cross Hyb Matching Probes None
GENEFINDER00000038912 1/11 Cross Hyb Matching Probes None
GENEFINDER00000040901 1/11 Cross Hyb Matching Probes None
SNAP00000040894 1/11 Cross Hyb Matching Probes None
SNAP00000004358 1/11 Cross Hyb Matching Probes None
SNAP00000014220 2/11 Cross Hyb Matching Probes None
SNAP00000014221 1/11 Cross Hyb Matching Probes None
GENEFINDER00000014231 2/11 Cross Hyb Matching Probes None
SNAP00000020588 1/11 Cross Hyb Matching Probes None
GENEFINDER00000020591 1/11 Cross Hyb Matching Probes None
SNAP00000020968 1/11 Cross Hyb Matching Probes None
GENEFINDER00000020971 1/11 Cross Hyb Matching Probes None
SNAP00000035101 1/11 Cross Hyb Matching Probes None
GENEFINDER00000035107 1/11 Cross Hyb Matching Probes None
SNAP00000005654 2/11 Cross Hyb Matching Probes None
SNAP00000005655 2/11 Cross Hyb Matching Probes None
GENEFINDER00000005663 2/11 Cross Hyb Matching Probes None
GENEFINDER00000005664 2/11 Cross Hyb Matching Probes None
SNAP00000017748 1/11 Cross Hyb Matching Probes None
GENEFINDER00000017752 1/11 Cross Hyb Matching Probes None
SNAP00000023158 2/11 Cross Hyb Matching Probes None
GENEFINDER00000023159 2/11 Cross Hyb Matching Probes None
SNAP00000023282 2/11 Cross Hyb Matching Probes None
GENEFINDER00000023293 2/11 Cross Hyb Matching Probes None
SNAP00000024853 1/11 Cross Hyb Matching Probes None
GENEFINDER00000024861 1/11 Cross Hyb Matching Probes None
SNAP00000032051 2/11 Cross Hyb Matching Probes None
GENEFINDER00000032086 2/11 Cross Hyb Matching Probes None
SNAP00000033943 1/11 Cross Hyb Matching Probes None
GENEFINDER00000033946 2/11 Cross Hyb Matching Probes None
SNAP00000035582 2/11 Cross Hyb Matching Probes None
GENEFINDER00000035589 2/11 Cross Hyb Matching Probes None
SNAP00000037122 2/11 Cross Hyb Matching Probes None
GENEFINDER00000037126 2/11 Cross Hyb Matching Probes None
SNAP00000043526 1/11 Cross Hyb Matching Probes None
GENEFINDER00000043530 1/11 Cross Hyb Matching Probes None
SNAP00000043808 1/11 Cross Hyb Matching Probes None
GENEFINDER00000043818 1/11 Cross Hyb Matching Probes None
SNAP00000002816 1/11 Cross Hyb Matching Probes None
SNAP00000002817 1/11 Cross Hyb Matching Probes None
GENEFINDER00000002822 1/11 Cross Hyb Matching Probes None
GENEFINDER00000002824 1/11 Cross Hyb Matching Probes None
SNAP00000007440 1/11 Cross Hyb Matching Probes None
GENEFINDER00000007452 1/11 Cross Hyb Matching Probes None
SNAP00000011265 1/11 Cross Hyb Matching Probes None
GENEFINDER00000011290 1/11 Cross Hyb Matching Probes None
SNAP00000011428 1/11 Cross Hyb Matching Probes None
GENEFINDER00000011431 1/11 Cross Hyb Matching Probes None
SNAP00000013927 6/11 Cross Hyb Matching Probes None
GENEFINDER00000013944 6/11 Cross Hyb Matching Probes None
SNAP00000023063 2/11 Cross Hyb Matching Probes None
GENEFINDER00000023069 2/11 Cross Hyb Matching Probes None
SNAP00000035388 1/11 Cross Hyb Matching Probes None
SNAP00000035390 1/11 Cross Hyb Matching Probes None
GENEFINDER00000035395 1/11 Cross Hyb Matching Probes None
GENEFINDER00000035407 1/11 Cross Hyb Matching Probes None
SNAP00000039737 1/11 Cross Hyb Matching Probes None
SNAP00000004400 1/11 Cross Hyb Matching Probes None
GENEFINDER00000004419 1/11 Cross Hyb Matching Probes None
SNAP00000004401 1/11 Cross Hyb Matching Probes None
GENEFINDER00000004417 1/11 Cross Hyb Matching Probes None
SNAP00000037973 1/11 Cross Hyb Matching Probes None
GENEFINDER00000037983 1/11 Cross Hyb Matching Probes None
Y54E10BL.2 1/11 Cross Hyb Matching Probes A 
T28F2.8 1/11 Cross Hyb Matching Probes A 
C15A11.1 1/11 Cross Hyb Matching Probes A 
C15A11.5 1/11 Cross Hyb Matching Probes A 
M195.1 1/11 Cross Hyb Matching Probes A 
C09G5.4 1/11 Cross Hyb Matching Probes A 
C09G5.5 1/11 Cross Hyb Matching Probes A 
F38A3.1 1/11 Cross Hyb Matching Probes A 
F09G8.6 1/11 Cross Hyb Matching Probes A 
ZK1010.7 1/11 Cross Hyb Matching Probes A 
Y38C1BA.3 1/11 Cross Hyb Matching Probes R A 
F30B5.1 2/11 Cross Hyb Matching Probes A 
Y73B6BL.34 1/11 Cross Hyb Matching Probes None
T28C6.4 1/11 Cross Hyb Matching Probes A 
T28C6.6 1/11 Cross Hyb Matching Probes A 
T05A1.2 1/11 Cross Hyb Matching Probes A 
C24F3.6 1/11 Cross Hyb Matching Probes None
C29F4.1.2 2/11 Cross Hyb Matching Probes None
C29F4.1.1 2/11 Cross Hyb Matching Probes None
F12F6.6 1/11 Cross Hyb Matching Probes None
M18.1 2/11 Cross Hyb Matching Probes A 
F52B11.4 2/11 Cross Hyb Matching Probes A 
F41F3.4 2/11 Cross Hyb Matching Probes A 
T15B7.4 1/11 Cross Hyb Matching Probes A 
T15B7.3 1/11 Cross Hyb Matching Probes A 
T06E4.6 1/11 Cross Hyb Matching Probes A 
F15H10.2 1/11 Cross Hyb Matching Probes A 
F15H10.1.2 1/11 Cross Hyb Matching Probes A 
F15H10.1.1 1/11 Cross Hyb Matching Probes A 
T11F9.9 6/11 Cross Hyb Matching Probes R A 
ZK863.2 1/11 Cross Hyb Matching Probes A 
C50B6.4 1/11 Cross Hyb Matching Probes A 
Y2H9A.3 1/11 Cross Hyb Matching Probes A 
C34F6.2 1/11 Cross Hyb Matching Probes A 
C34F6.3 1/11 Cross Hyb Matching Probes A 
C44C10.1 1/11 Cross Hyb Matching Probes A 
Genomic Alignment of Consensus/Exemplar Sequence
Assembly Wormbase March 2004
Alignment(s)
Position Identity Coverage Cytoband
chrV:11388063-11388931(+) 98.88 98.88
chrV:11486740-11487586(+) 90.76 96.0
chrV:11391477-11392345(-) 95.13 100.0
Public Domain and Genome References
Gene Title collagen
collagen
Gene Symbol col-154
col-155
Ensembl F55C10.2
F55C10.3
Entrez Gene 186300 Entrez gene
186301 Entrez gene
SwissProt Q20805 EMBL-EBI
Q21184 EMBL-EBI
WormBase CE05952 Wormbase
CE11182 Wormbase
Functional Annotations
Gene Ontology
GO Biological Process (view graph)
ID Description Evidence Links
6817 phosphate transport inferred from electronic annotation QuickGO AmiGO
GO Cellular Component (view graph)
ID Description Evidence Links
5737 cytoplasm inferred from electronic annotation QuickGO AmiGO
GO Molecular Function (view graph)
ID Description Evidence Links
42302 structural constituent of cuticle inferred from electronic annotation QuickGO AmiGO
Protein Similarities
Method ID Description E-Value
blast CAA98486 Hypothetical protein F55C10.2 [Caenorhabditis elegans] ref|NP_505886.1| F55C10.2 [Caenorhabditis elegans] 2.0E-34
blast CAE75258 Hypothetical protein CBG23219 [Caenorhabditis briggsae] 2.0E-33
blast CAE75236 Hypothetical protein CBG23187 [Caenorhabditis briggsae] 2.0E-33
Protein Domains
Database ID Description E-Value
Pfam IPR002486 EMBL-EBI Nematode cuticle collagen, N-terminal 7.3E-9
Pfam IPR008160 EMBL-EBI Collagen triple helix repeat 3.5E-9
Pfam IPR008160 EMBL-EBI Collagen triple helix repeat 1.1E-13
Pfam IPR008160 EMBL-EBI Collagen triple helix repeat 3.5E-9
Pfam IPR008160 EMBL-EBI Collagen triple helix repeat 1.1E-13
Pfam IPR008160 EMBL-EBI Collagen triple helix repeat 3.5E-9
Pfam IPR008160 EMBL-EBI Collagen triple helix repeat 1.1E-13
Trans Membrane
ID Number Of Domains Domain Boundaries
NP_505886.1 1 12-34
F55C10.2 1 12-34
SNAP00000017929 1 12-34
GENEFINDER00000017933 1 12-34
Sequence
Target Sequence 
>C. ELEGANS:172753_X_AT
ggaggatgtgatgcttgctgcttgccaggagctgctggaccagccggaacaccaggaaag
ccaggacgtccaggaaagccaggagcaccaggacttccaggaaacccaggacacccacca
cagcaaccatgtgacccaatcactccaccaccatgccaaccatgcccacaaggaccacct
gggccaccaggaccaccaggaccatctggagatgctggaggcaacggaaacccaggatcc
ccaggacaagatggacagccaggagctccaggaaacaagggaccttctggaccaaatgga
aacccaggagctccaggagcaccaggacaaccaggacaagatgctccatccgagccaatt
actccaggagctccaggaccacaaggaaccccaggaccacaaggaccgccaggacagcca
ggacaaccaggacacgatggacaaccaggagctccaggaccaaagggaccaaatggaaat
ccaggacaaccaggagccgatggaaatccaggagcaccaggacaatctggaaccccagga
ggagtcggaga

BLASTn GenBank NR
Probe Info
Probe Sequence(5'-3') Probe X Probe Y Probe Interrogation
Position 		Strandedness
GGAGGATGTGATGCTTGCTGCTTGC 26 517 193 Antisense
TGCTGCTTGCCAGGAGCTGCTGGAC 453 581 208 Antisense
GAAAGCCAGGAGCACCAGGACTTCC 319 359 266 Antisense
ACAAGGGACCTTCTGGACCAAATGG 52 3 467 Antisense
GAAACCCAGGAGCTCCAGGAGCACC 660 355 491 Antisense
CAGGAGCACCAGGACAACCAGGACA 15 209 506 Antisense
TCCATCCGAGCCAATTACTCCAGGA 334 591 537 Antisense
TCCAGGAGCTCCAGGACCACAAGGA 478 589 555 Antisense
ACAGCCAGGA