[Home] | [Total List]

[172734_x_at] Major sperm protein

Description ZK1248.4 /REP_DB=WormBase Gene ID /WP=CE02603 /GB=AAC71085.1 /SUBMIT=ST.LOUIS /CHR=2 /FEA=Sanger Annotation /DEF=Major sperm protein
Cluster 6grp_high1_10_10 > 88      4grp_high_8_8 > 20      6grp_total > 88      4grp_total > 11      6grp_high1_sub > Da      6grp_total_sub > Increase      6grp_rule_based > S6      

Scale
G range Absolute graph Relative graph Expression Table Dauer Comp.
4 136
1 2 3 4 range
A 78.3
(-1.6)
P 		101.9
(0.1)
P 		60.3
(-3)
M 		139.9
(3)
P 		80
B 80.6
(-2.8)
P 		96.5
(-0.8)
P 		79.3
(-3)
A 		125.8
(3)
P 		47
C 117.5
(-0.7)
P 		79.3
(-2.5)
P 		69.7
(-3)
P 		196
(3)
P 		126
avr 92.1
(-1.4) 		92.6
(-1.4) 		69.8
(-3) 		153.9
(3) 		84

1 : 1 state (S1, L1)
2 : dauer (ST, LT)
6 1409
1 2 3 4 5 6 range
A 92
(-2.7)
P 		47.7
(-3)
P 		96.7
(-2.7)
P 		199.6
(-2)
P 		521.3
(0.1)
P 		974.8
(3)
P 		927
B 58.2
(-3)
P 		69.4
(-2.9)
P 		109.6
(-2.6)
P 		176.6
(-2.1)
P 		722.9
(1.8)
P 		889.5
(3)
P 		831
C 77.7
(-3)
M 		103.1
(-2.8)
P 		67.3
(-3)
P 		184.5
(-2.5)
P 		641.9
(-0.5)
P 		1456.3
(3)
P 		1389
avr 76
(-3) 		73.4
(-3) 		91.2
(-2.9) 		186.9
(-2.3) 		628.7
(0.2) 		1106.9
(3) 		1034
No Scale
G range Absolute graph Relative graph Expression Table Dauer Comp.
4 23
1 2 3 4 range
A 28.5
(3)
P 		22.1
(-0)
P 		15.8
(-3)
M 		20.5
(-0.8)
P 		13
B 25.7
(2.2)
P 		23.8
(0.9)
P 		18.4
(-3)
A 		26.8
(3)
P 		8
C 38.9
(3)
P 		22.8
(-3)
P 		24.3
(-2.4)
P 		33
(0.8)
P 		16
avr 31
(3) 		22.9
(-1.2) 		19.5
(-3) 		26.8
(0.8) 		12

1 : 1 state (S1, L1)
2 : dauer (ST, LT)
6 471
1 2 3 4 5 6 range
A 17
(-3)
P 		17
(-3)
P 		21.1
(-2.9)
P 		50.6
(-2.1)
P 		157.3
(0.8)
P 		237.3
(3)
P 		220
B 20.2
(-3)
P 		23.1
(-2.9)
P 		26.6
(-2.9)
P 		46.8
(-2.5)
P 		293.7
(2.3)
P 		331.7
(3)
P 		312
C 28.8
(-2.9)
M 		31.5
(-2.8)
P 		17.1
(-3)
P 		37.1
(-2.7)
P 		207.7
(-0.6)
P 		487.5
(3)
P 		470
avr 22
(-3) 		23.9
(-3) 		21.6
(-3) 		44.8
(-2.6) 		219.6
(0.6) 		352.2
(3) 		331
NetAffx Links Cluster Members
Consensus/Exemplar
Group Members
GeneChip Array Information
Probe Set ID 172734_x_at
GeneChip Array C. elegans Genome Array
Organism Common Name Nematode
Probe Design Information
Transcript ID(Array Design) affy.Ce.5870
Sequence Type Exemplar sequence
Representative Public ID ZK1248.4 NCBI
Target Description ZK1248.4 /REP_DB=WormBase Gene ID /WP=CE02603 /GB=AAC71085.1 /SUBMIT=ST.LOUIS /CHR=2 /FEA=Sanger Annotation /DEF=Major sperm protein
Cluster Evidence This cluster is supported by a Sanger Annotation.
Annotation Method Description
Annotation Description This probe set was annotated using the Matching Probes based pipeline to a RefSeq identifier using 1 transcript(s).
Annotation Grade This is a grade A annotation.
Annotation Transcript Cluster (# of Matching Probes) NM_062753(11)
Transcript Assignments
Representative
Transcript		 Description Matching Probes Related Probesets by Grade
NM_062753 NCBI Caenorhabditis elegans ZK1248.4 (ZK1248.4) mRNA, complete cds. 11/11 None
SNAP00000041374 ENSEMBL cdna:SNAP chromosome:CEL140:II:5818562:5818795:1 11/11 None
GENEFINDER00000041386 ENSEMBL cdna:GeneFinder chromosome:CEL140:II:5818562:5818795:1 11/11 None
ZK1248.4 ENSEMBL cdna:known chromosome:CEL140:II:5818562:5818795:1 gene:ZK1248.4 11/11 None
Annotation Notes
Cross Hybridizing mRNA Matched Probes Nature of Assignment Related Probesets by Grade
NM_062487 1/11 Cross Hyb Matching Probes A 
NM_069433 1/11 Cross Hyb Matching Probes A 
NM_062497 1/11 Cross Hyb Matching Probes A 
NM_068370 2/11 Cross Hyb Matching Probes A 
NM_069448 1/11 Cross Hyb Matching Probes A 
NM_068310 2/11 Cross Hyb Matching Probes A 
NM_068312 2/11 Cross Hyb Matching Probes A 
NM_068313 2/11 Cross Hyb Matching Probes A 
NM_062548 1/11 Cross Hyb Matching Probes A 
NM_062558 1/11 Cross Hyb Matching Probes A 
NM_062559 1/11 Cross Hyb Matching Probes A 
NM_062569 1/11 Cross Hyb Matching Probes A 
NM_062571 1/11 Cross Hyb Matching Probes A 
NM_068351 2/11 Cross Hyb Matching Probes A 
NM_068354 2/11 Cross Hyb Matching Probes A 
NM_062505 1/11 Cross Hyb Matching Probes A 
NM_068359 2/11 Cross Hyb Matching Probes A 
NM_068377 2/11 Cross Hyb Matching Probes A 
NM_068379 2/11 Cross Hyb Matching Probes A 
NM_062490 1/11 Cross Hyb Matching Probes A 
NM_062500 1/11 Cross Hyb Matching Probes A 
NM_062742 5/11 Cross Hyb Matching Probes A 
NM_062743 5/11 Cross Hyb Matching Probes A 
NM_062748 5/11 Cross Hyb Matching Probes A 
NM_069321 2/11 Cross Hyb Matching Probes A 
NM_069339 2/11 Cross Hyb Matching Probes A 
NM_069341 2/11 Cross Hyb Matching Probes A 
NM_069358 2/11 Cross Hyb Matching Probes A 
NM_069359 2/11 Cross Hyb Matching Probes A 
NM_069361 2/11 Cross Hyb Matching Probes A 
NM_069380 2/11 Cross Hyb Matching Probes A 
NM_062457 1/11 Cross Hyb Matching Probes A 
NM_062764 3/11 Cross Hyb Matching Probes A 
NM_062464 1/11 Cross Hyb Matching Probes A 
NM_068372 2/11 Cross Hyb Matching Probes A 
SNAP00000024816 2/11 Cross Hyb Matching Probes None
GENEFINDER00000024829 2/11 Cross Hyb Matching Probes None
SNAP00000000807 1/11 Cross Hyb Matching Probes None
SNAP00000000808 1/11 Cross Hyb Matching Probes None
GENEFINDER00000000821 1/11 Cross Hyb Matching Probes None
GENEFINDER00000000824 1/11 Cross Hyb Matching Probes None
SNAP00000007649 1/11 Cross Hyb Matching Probes None
GENEFINDER00000007652 1/11 Cross Hyb Matching Probes None
SNAP00000009139 1/11 Cross Hyb Matching Probes None
GENEFINDER00000009155 1/11 Cross Hyb Matching Probes None
SNAP00000016470 1/11 Cross Hyb Matching Probes None
GENEFINDER00000016484 1/11 Cross Hyb Matching Probes None
SNAP00000019951 1/11 Cross Hyb Matching Probes None
SNAP00000019952 1/11 Cross Hyb Matching Probes None
GENEFINDER00000019958 1/11 Cross Hyb Matching Probes None
GENEFINDER00000019959 1/11 Cross Hyb Matching Probes None
SNAP00000021327 1/11 Cross Hyb Matching Probes None
SNAP00000021329 1/11 Cross Hyb Matching Probes None
GENEFINDER00000021346 1/11 Cross Hyb Matching Probes None
GENEFINDER00000021348 1/11 Cross Hyb Matching Probes None
SNAP00000031244 5/11 Cross Hyb Matching Probes None
SNAP00000031245 5/11 Cross Hyb Matching Probes None
GENEFINDER00000031253 5/11 Cross Hyb Matching Probes None
GENEFINDER00000031258 5/11 Cross Hyb Matching Probes None
SNAP00000034943 1/11 Cross Hyb Matching Probes None
SNAP00000034948 1/11 Cross Hyb Matching Probes None
GENEFINDER00000034961 1/11 Cross Hyb Matching Probes None
GENEFINDER00000034965 1/11 Cross Hyb Matching Probes None
SNAP00000041369 5/11 Cross Hyb Matching Probes None
SNAP00000041384 3/11 Cross Hyb Matching Probes None
GENEFINDER00000041391 3/11 Cross Hyb Matching Probes None
GENEFINDER00000041398 5/11 Cross Hyb Matching Probes None
SNAP00000043868 1/11 Cross Hyb Matching Probes None
SNAP00000043869 1/11 Cross Hyb Matching Probes None
SNAP00000043876 1/11 Cross Hyb Matching Probes None
GENEFINDER00000043883 1/11 Cross Hyb Matching Probes None
GENEFINDER00000043888 1/11 Cross Hyb Matching Probes None
SNAP00000002639 2/11 Cross Hyb Matching Probes None
SNAP00000002641 2/11 Cross Hyb Matching Probes None
GENEFINDER00000002656 2/11 Cross Hyb Matching Probes None
GENEFINDER00000002661 2/11 Cross Hyb Matching Probes None
SNAP00000004243 2/11 Cross Hyb Matching Probes None
SNAP00000004244 2/11 Cross Hyb Matching Probes None
SNAP00000004246 2/11 Cross Hyb Matching Probes None
GENEFINDER00000004263 2/11 Cross Hyb Matching Probes None
GENEFINDER00000004265 2/11 Cross Hyb Matching Probes None
GENEFINDER00000004273 2/11 Cross Hyb Matching Probes None
SNAP00000005864 1/11 Cross Hyb Matching Probes None
GENEFINDER00000005869 1/11 Cross Hyb Matching Probes None
SNAP00000006004 2/11 Cross Hyb Matching Probes None
SNAP00000006006 2/11 Cross Hyb Matching Probes None
SNAP00000006011 2/11 Cross Hyb Matching Probes None
SNAP00000006013 2/11 Cross Hyb Matching Probes None
SNAP00000006015 2/11 Cross Hyb Matching Probes None
GENEFINDER00000006018 2/11 Cross Hyb Matching Probes None
GENEFINDER00000006020 2/11 Cross Hyb Matching Probes None
GENEFINDER00000006021 2/11 Cross Hyb Matching Probes None
GENEFINDER00000006023 2/11 Cross Hyb Matching Probes None
GENEFINDER00000006024 2/11 Cross Hyb Matching Probes None
SNAP00000007231 2/11 Cross Hyb Matching Probes None
GENEFINDER00000007236 2/11 Cross Hyb Matching Probes None
SNAP00000023386 2/11 Cross Hyb Matching Probes None
GENEFINDER00000023395 2/11 Cross Hyb Matching Probes None
SNAP00000029404 2/11 Cross Hyb Matching Probes None
SNAP00000029405 2/11 Cross Hyb Matching Probes None
GENEFINDER00000029413 2/11 Cross Hyb Matching Probes None
GENEFINDER00000029416 2/11 Cross Hyb Matching Probes None
SNAP00000034129 2/11 Cross Hyb Matching Probes None
SNAP00000034134 2/11 Cross Hyb Matching Probes None
GENEFINDER00000034137 2/11 Cross Hyb Matching Probes None
GENEFINDER00000034140 2/11 Cross Hyb Matching Probes None
SNAP00000040134 1/11 Cross Hyb Matching Probes None
GENEFINDER00000040145 1/11 Cross Hyb Matching Probes None
SNAP00000041533 2/11 Cross Hyb Matching Probes None
GENEFINDER00000041543 2/11 Cross Hyb Matching Probes None
SNAP00000043472 2/11 Cross Hyb Matching Probes None
SNAP00000043475 2/11 Cross Hyb Matching Probes None
GENEFINDER00000043484 2/11 Cross Hyb Matching Probes None
GENEFINDER00000043489 2/11 Cross Hyb Matching Probes None
F26G1.7 1/11 Cross Hyb Matching Probes A 
F26G1.8 1/11 Cross Hyb Matching Probes None
C33F10.9 1/11 Cross Hyb Matching Probes A 
R05F9.8 1/11 Cross Hyb Matching Probes A 
R05F9.3 1/11 Cross Hyb Matching Probes R A 
R05F9.13 1/11 Cross Hyb Matching Probes A 
ZK546.6 1/11 Cross Hyb Matching Probes A 
ZK546.3 1/11 Cross Hyb Matching Probes A 
F59A6.8 1/11 Cross Hyb Matching Probes None
F09C12.7 1/11 Cross Hyb Matching Probes A 
F58A6.8 1/11 Cross Hyb Matching Probes A 
F58A6.9 1/11 Cross Hyb Matching Probes A 
C34F11.6 1/11 Cross Hyb Matching Probes A 
C34F11.4 1/11 Cross Hyb Matching Probes A 
K05F1.7 5/11 Cross Hyb Matching Probes A 
K05F1.2 5/11 Cross Hyb Matching Probes A 
ZK1248.6 5/11 Cross Hyb Matching Probes A 
ZK1248.17 3/11 Cross Hyb Matching Probes A 
C09B9.6 2/11 Cross Hyb Matching Probes A 
R13H9.2 2/11 Cross Hyb Matching Probes A 
R13H9.4 2/11 Cross Hyb Matching Probes A 
Y59E9AR.7 2/11 Cross Hyb Matching Probes A 
Y59E9AR.1 2/11 Cross Hyb Matching Probes A 
F36H12.7 2/11 Cross Hyb Matching Probes A 
F36H12.6 2/11 Cross Hyb Matching Probes None
ZK354.5 2/11 Cross Hyb Matching Probes A 
ZK354.4 2/11 Cross Hyb Matching Probes A 
ZK354.10 2/11 Cross Hyb Matching Probes None
ZK354.11 2/11 Cross Hyb Matching Probes A 
ZK354.1 2/11 Cross Hyb Matching Probes A 
ZK1251.6 2/11 Cross Hyb Matching Probes A 
T13F2.10 2/11 Cross Hyb Matching Probes A 
T13F2.11 2/11 Cross Hyb Matching Probes A 
K07F5.1 2/11 Cross Hyb Matching Probes A 
K07F5.2 2/11 Cross Hyb Matching Probes A 
K07F5.3 2/11 Cross Hyb Matching Probes A 
F32B6.6 2/11 Cross Hyb Matching Probes A 
C04G2.3 1/11 Cross Hyb Matching Probes None
C04G2.4 1/11 Cross Hyb Matching Probes A 
K08F4.8 1/11 Cross Hyb Matching Probes A 
Genomic Alignment of Consensus/Exemplar Sequence
Assembly Wormbase March 2004
Alignment(s)
Position Identity Coverage Cytoband
chrII:5818558-5818792(+) 100.0 100.0
chrII:5798038-5798270(+) 92.74 92.74
chrIV:8571575-8571809(+) 90.17 90.17
chrII:5797026-5797260(-) 93.59 93.59
Public Domain and Genome References
Gene Title Major sperm protein
Ensembl ZK1248.4
Entrez Gene 173984 Entrez gene
SwissProt Q95PJ7 EMBL-EBI
WormBase CE02603 Wormbase
Functional Annotations
Protein Similarities
Method ID Description E-Value
blast AAF60826 Hypothetical protein Y59E9AR.7 [Caenorhabditis elegans] gb|AAF60828.1| Hypothetical protein Y59E9AR.1 [Caenorhabditis elegans] ref|NP_500755.1| Y59E9AR.1 [Caenorhabditis elegans] ref|NP_500752.1| Y59E9AR.7 [Caenorhabditis elegans] 1.0E-40
blast AAA68346 Major sperm protein protein 74 [Caenorhabditis elegans] gb|AAC71085.1| Hypothetical protein ZK1248.4 [Caenorhabditis elegans] gb|AAA96205.1| Hypothetical protein F58A6.9 [Caenorhabditis elegans] ref|NP_495154.1| ZK1248.4 [Caenorhabditis elegans] ref|NP_494960.1| F58A6.9 [Caenorhabditis elegans] ref|NP_494949.1| Major Sperm Protein family member (msp-74) [Caenorhabditis elegans] 1.0E-40
blast AAA68714 Major sperm protein protein 63 [Caenorhabditis elegans] ref|NP_495143.1| Major Sperm Protein family member (msp-63) [Caenorhabditis elegans] sp|Q21244|MSP63_CAEEL Major sperm protein 63 (MSP) 1.0E-40
Protein Domains
Database ID Description E-Value
Pfam IPR000535 EMBL-EBI Major sperm protein (MSP) domain 7.2E-15
Sequence
Target Sequence 
>C. ELEGANS:172734_X_AT
gagacttggagttgatccaccatgtggagttctcgacccaaaggaagctgtgctgttggc
tgtttcgtgtgatgcattcgcatttggacaggaagacaccaacaacgaccgtatcaccgt
cgaatggactaacactccggatggagctgccaagcagttccgccgcgagtggttccaggg
agatggtatggttcgccgc

BLASTn GenBank NR
Probe Info
Probe Sequence(5'-3') Probe X Probe Y Probe Interrogation
Position 		Strandedness
GAGACTTGGAGTTGATCCACCATGT 579 393 18 Antisense
ACCATGTGGAGTTCTCGACCCAAAG 513 83 36 Antisense
AGGAAGCTGTGCTGTTGGCTGTTTC 444 55 59 Antisense
GGCTGTTTCGTGTGATGCATTCGCA 377 539 75 Antisense
GGACAGGAAGACACCAACAACGACC 84 523 103 Antisense
CAACAACGACCGTATCACCGTCGAA 246 189 117 Antisense
CACCGTCGAATGGACTAACACTCCG 327 199 132 Antisense
AATGGACTAACACTCCGGATGGAGC 702 161 140 Antisense
GGATGGAGCTGCCAAGCAGTTCCGC 406 515 156 Antisense
GCCGCGAGTGGTTCCAGGGAGATGG 1 287 179 Antisense
CCAGGGAGATGGTATGGTTCGCCGC 14 265 192 Antisense
Sequence Source Affymetrix Proprietary Database