[Home] | [Total List]

[172733_x_at] --- /// histone H4 /// histone H4 /// histone H4

Description F45F2.3 /REP_DB=WormBase Gene ID /WP=CE03252 /GEN=his-5 /GB=AAC48026.1 /SUBMIT=ST.LOUIS /CHR=5 /FEA=Sanger Annotation /DEF=histone H4
Cluster 6grp_highest_10_10 > 69      6grp_high1_10_10 > 98      4grp_highest_8_8 > 11      4grp_high_8_8 > 47      6grp_highest_nonorm > 89      6grp_total > 96      4grp_total > 48      6grp_highest_sub > In      6grp_cgc > 68      6grp_high1_sub > In      6grp_cgc_sub > In      6grp_total_sub > Increase      6grp_rule_based > S6      4grp_rule_based > L3      

Scale
G range Absolute graph Relative graph Expression Table Dauer Comp.
4 1616
1 2 3 4 range
A 503.9
(-3)
P 		1445.7
(0.5)
P 		2120
(3)
P 		940.7
(-1.4)
P 		1616
B 516.8
(-3)
P 		1497
(0.8)
P 		2055.5
(3)
P 		713.6
(-2.2)
P 		1539
C 604.4
(-3)
P 		1699.6
(2.6)
P 		1771.1
(3)
P 		866.4
(-1.7)
P 		1167
avr 541.7
(-3) 		1547.4
(1.2) 		1982.2
(3) 		840.2
(-1.8) 		1441

1 : 1 state (S1, L1)
2 : dauer (ST, LT)
6 1689
1 2 3 4 5 6 range
A 663.5
(-3)
P 		747.3
(-2.6)
P 		872.9
(-2)
P 		1524.9
(1)
P 		1562
(1.1)
P 		1963.7
(3)
P 		1300
B 654
(-3)
P 		689.9
(-2.8)
P 		905.2
(-1.8)
P 		1179.5
(-0.5)
P 		1797.8
(2.5)
P 		1898.1
(3)
P 		1244
C 759.3
(-2.4)
P 		602.2
(-3)
P 		981.2
(-1.7)
P 		1223.4
(-0.8)
P 		1605
(0.6)
P 		2291.1
(3)
P 		1689
avr 692.3
(-2.9) 		679.8
(-3) 		919.8
(-1.9) 		1309.3
(-0.2) 		1654.9
(1.3) 		2051
(3) 		1371
No Scale
G range Absolute graph Relative graph Expression Table Dauer Comp.
4 480
1 2 3 4 range
A 183.5
(-2.3)
P 		313.8
(-0.5)
P 		554.2
(3)
P 		137.7
(-3)
P 		417
B 164.8
(-2.8)
P 		369.7
(1)
P 		476.3
(3)
P 		152.1
(-3)
P 		324
C 200.1
(-2.3)
P 		488.7
(1.4)
P 		617.3
(3)
P 		146.1
(-3)
P 		471
avr 182.8
(-2.4) 		390.7
(0.6) 		549.3
(3) 		145.3
(-3) 		404

1 : 1 state (S1, L1)
2 : dauer (ST, LT)
6 645
1 2 3 4 5 6 range
A 122.3
(-3)
P 		265.8
(-0.6)
P 		190.1
(-1.9)
P 		386.8
(1.5)
P 		471.3
(2.9)
P 		478.1
(3)
P 		356
B 227.6
(-2.9)
P 		229.6
(-2.9)
P 		219.8
(-3)
P 		312.4
(-1.9)
P 		730.4
(3)
P 		707.8
(2.7)
P 		511
C 281.5
(-2)
P 		183.8
(-3)
P 		249.7
(-2.3)
P 		246
(-2.4)
P 		519.4
(0.5)
P 		767
(3)
P 		583
avr 210.5
(-3) 		226.4
(-2.8) 		219.9
(-2.9) 		315.1
(-1.6) 		573.7
(1.9) 		651
(3) 		441
NetAffx Links Cluster Members
Consensus/Exemplar
Group Members
GeneChip Array Information
Probe Set ID 172733_x_at
GeneChip Array C. elegans Genome Array
Organism Common Name Nematode
Probe Design Information
Transcript ID(Array Design) affy.Ce.12396
Sequence Type Exemplar sequence
Representative Public ID F45F2.3 NCBI
Target Description F45F2.3 /REP_DB=WormBase Gene ID /WP=CE03252 /GEN=his-5 /GB=AAC48026.1 /SUBMIT=ST.LOUIS /CHR=5 /FEA=Sanger Annotation /DEF=histone H4
Cluster Evidence This cluster is supported by a Sanger Annotation.
Annotation Method Description
Annotation Description This probe set was annotated using the Matching Probes based pipeline to a RefSeq identifier using 1 transcript(s).
Annotation Grade This is a grade A annotation.
Annotation Transcript Cluster (# of Matching Probes) NM_072799(11), NM_072874(9), NM_072890(9), NM_072897(9)
Transcript Assignments
Representative
Transcript		 Description Matching Probes Related Probesets by Grade
NM_072799 NCBI Caenorhabditis elegans HIStone family member (his-5) (his-5) mRNA, complete cds. 11/11 A 
NM_072874 NCBI Caenorhabditis elegans HIStone family member (his-50) (his-50) mRNA, complete cds. 9/11 A 
NM_072890 NCBI Caenorhabditis elegans HIStone family member (his-28) (his-28) mRNA, complete cds. 9/11 A 
NM_072897 NCBI Caenorhabditis elegans HIStone family member (his-18) (his-18) mRNA, complete cds. 9/11 A 
SNAP00000015091 ENSEMBL cdna:SNAP chromosome:CEL140:V:8849980:8850291:-1 9/11 None
GENEFINDER00000015147 ENSEMBL cdna:GeneFinder chromosome:CEL140:V:8849980:8850291:-1 9/11 None
SNAP00000018182 ENSEMBL cdna:SNAP chromosome:CEL140:V:8892075:8892386:-1 9/11 None
SNAP00000018189 ENSEMBL cdna:SNAP chromosome:CEL140:V:8900815:8901126:1 9/11 None
GENEFINDER00000018193 ENSEMBL cdna:GeneFinder chromosome:CEL140:V:8892075:8892386:-1 9/11 None
GENEFINDER00000018202 ENSEMBL cdna:GeneFinder chromosome:CEL140:V:8900815:8901126:1 9/11 None
SNAP00000030774 ENSEMBL cdna:SNAP chromosome:CEL140:V:8537802:8538113:1 11/11 None
GENEFINDER00000030786 ENSEMBL cdna:GeneFinder chromosome:CEL140:V:8537802:8538113:1 11/11 None
F45F2.3 ENSEMBL cdna:known chromosome:CEL140:V:8537802:8538113:1 gene:F45F2.3 11/11 A 
F07B7.9 ENSEMBL cdna:known chromosome:CEL140:V:8849980:8850291:-1 gene:F07B7.9 9/11 A 
K06C4.2 ENSEMBL cdna:known chromosome:CEL140:V:8892075:8892386:-1 gene:K06C4.2 9/11 A 
K06C4.10 ENSEMBL cdna:known chromosome:CEL140:V:8900815:8901126:1 gene:K06C4.10 9/11 A 
Annotation Notes
Cross Hybridizing mRNA Matched Probes Nature of Assignment Related Probesets by Grade
NM_074633 4/11 Cross Hyb Matching Probes A 
NM_076830 4/11 Cross Hyb Matching Probes A 
NM_068802 1/11 Cross Hyb Matching Probes A 
NM_060240 1/11 Cross Hyb Matching Probes A 
NM_069753 1/11 Cross Hyb Matching Probes A 
SNAP00000036751 1/11 Cross Hyb Matching Probes None
GENEFINDER00000036760 1/11 Cross Hyb Matching Probes None
SNAP00000005173 1/11 Cross Hyb Matching Probes None
GENEFINDER00000005186 1/11 Cross Hyb Matching Probes None
SNAP00000028587 1/11 Cross Hyb Matching Probes None
GENEFINDER00000028597 1/11 Cross Hyb Matching Probes None
SNAP00000027917 4/11 Cross Hyb Matching Probes None
GENEFINDER00000027926 4/11 Cross Hyb Matching Probes None
SNAP00000013867 4/11 Cross Hyb Matching Probes None
GENEFINDER00000013872 4/11 Cross Hyb Matching Probes None
T23D8.5 1/11 Cross Hyb Matching Probes A 
F55G1.11 1/11 Cross Hyb Matching Probes A 
F22B3.1 1/11 Cross Hyb Matching Probes A 
T10C6.14 4/11 Cross Hyb Matching Probes A 
K03A1.6 4/11 Cross Hyb Matching Probes A 
Genomic Alignment of Consensus/Exemplar Sequence
Assembly Wormbase March 2004
Alignment(s)
Position Identity Coverage Cytoband
chrIV:11407092-11407404(+) 90.06 90.06
chrIV:11338498-11338810(+) 90.06 90.06
chrV:8537802-8538114(+) 100.0 100.0
chrV:8900815-8901127(+) 99.68 99.68
chrV:16045102-16045414(+) 96.47 96.47
chrII:13825425-13825737(+) 90.06 90.06
chrIV:11325994-11326306(-) 90.06 90.06
chrIV:8333659-8333971(-) 90.06 90.06
chrV:8892075-8892387(-) 99.36 99.36
chrV:8849980-8850292(-) 99.36 99.36
chrX:7309508-7309820(-) 96.79 96.79
chrII:13822957-13823269(-) 90.06 90.06
chrII:13819519-13819831(-) 90.06 90.06
Public Domain and Genome References
Gene Title
histone H4
histone H4
histone H4
Gene Symbol his-50
his-5
his-18
his-28
Ensembl F45F2.3
F07B7.9
K06C4.2
K06C4.10
Entrez Gene 179233 Entrez gene
179260 Entrez gene
179264 Entrez gene
179267 Entrez gene
SwissProt P62784 EMBL-EBI
WormBase CE03252 Wormbase
CE03252 Wormbase
CE03252 Wormbase
CE03252 Wormbase
Functional Annotations
Ortholog
ID Title Organism
HG-U133_PLUS_2:232035_AT histone 1, H4h hs
HG-U133B:232035_AT histone 1, H4h hs
HG-U133A:208180_S_AT histone 1, H4h hs
HG-U133_PLUS_2:208180_S_AT histone 1, H4h hs
HG-U133A_2:208180_S_AT histone 1, H4h hs
HG-U133A:208181_AT histone 1, H4h hs
HG-U133_PLUS_2:208181_AT histone 1, H4h hs
HG-FOCUS:208181_AT histone 1, H4h hs
HG-U133A_2:208181_AT histone 1, H4h hs
U133_X3P:G5579466_3P_AT histone 1, H4h hs
U133_X3P:G5579466_3P_A_AT histone 1, H4h hs
U133_X3P:HS.93758.1.S1_3P_X_AT histone 1, H4h hs
U133_X3P:HS.93758.1.S1_3P_AT histone 1, H4h hs
HG-U95C:50025_AT Histone 1, H4h hs
HG-U133_PLUS_2:232035_AT histone 1, H4h hs
HG-U133B:232035_AT histone 1, H4h hs
HG-U133A:208180_S_AT histone 1, H4h hs
HG-U133_PLUS_2:208180_S_AT histone 1, H4h hs
HG-U133A_2:208180_S_AT histone 1, H4h hs
HG-U133A:208181_AT histone 1, H4h hs
HG-U133_PLUS_2:208181_AT histone 1, H4h hs
HG-FOCUS:208181_AT histone 1, H4h hs
HG-U133A_2:208181_AT histone 1, H4h hs
U133_X3P:G5579466_3P_AT histone 1, H4h hs
U133_X3P:G5579466_3P_A_AT histone 1, H4h hs
U133_X3P:HS.93758.1.S1_3P_X_AT histone 1, H4h hs
U133_X3P:HS.93758.1.S1_3P_AT histone 1, H4h hs
HG-U95C:50025_AT Histone 1, H4h hs
RG-U34A:RC_AA892647_AT histone 1, H4m (predicted) rn
RG-U34B:RC_AA956968_AT histone 1, H4m (predicted) rn
RAE230A:1369728_AT histone 1, H4m (predicted) rn
RAT230_2:1369728_AT histone 1, H4m (predicted) rn
RG-U34A:RC_AA892647_AT histone 1, H4m (predicted) rn
RG-U34B:RC_AA956968_AT histone 1, H4m (predicted) rn
RAE230A:1369728_AT histone 1, H4m (predicted) rn
RAT230_2:1369728_AT histone 1, H4m (predicted) rn
Gene Ontology
GO Biological Process (view graph)
ID Description Evidence Links
6334 nucleosome assembly inferred from electronic annotation QuickGO AmiGO
7001 chromosome organization and biogenesis (sensu Eukaryota) inferred from electronic annotation QuickGO AmiGO
GO Cellular Component (view graph)
ID Description Evidence Links
786 nucleosome inferred from electronic annotation QuickGO AmiGO
5634 nucleus inferred from electronic annotation QuickGO AmiGO
GO Molecular Function (view graph)
ID Description Evidence Links
3677 DNA binding inferred from electronic annotation QuickGO AmiGO
Protein Similarities
Method ID Description E-Value
blast CAB05839 Hypothetical protein ZK131.8 [Caenorhabditis elegans] emb|CAB05837.1| Hypothetical protein ZK131.4 [Caenorhabditis elegans] emb|CAB05835.4| Hypothetical protein ZK131.1 [Caenorhabditis elegans] emb|CAB03396.1| Hypothetical protein T23D8.5 [Caenorhabditis elegans] emb|CAA94742.1| Hypothetical protein C50F4.7 [Caenorhabditis elegans] emb|CAA97407.1| Hypothetical protein B0035.9 [Caenorhabditis elegans] emb|CAA92734.1| Hypothetical protein F22B3.1 [Caenorhabditis elegans] emb|CAB07657.1| Hypothetical protein T10C6.14 [Caenorhabditis elegans] emb|CAB05210.1| Hypothetical protein F54E12.3 [Caenorhabditis elegans] gb|AAC05101.1| Histone protein 31 [Caenorhabditis elegans] gb|AAK84518.1| Histone protein 50 [Caenorhabditis elegans] gb|AAF98220.1| Histone protein 28 [Caenorhabditis elegans] gb|AAF98223.1| Histone protein 18 [Caenorhabditis elegans] gb|AAA83329.1| Histone protein 38 [Caenorhabditis elegans] emb|CAA24645.1| unnamed protein product [Strongylocentrotus purpuratus] emb|CAA38053.1| histone H4 [Pycnopodia helianthoides] emb|CAA38051.1| histone H4 [Pisaster ochraceus] emb|CAA38049.1| H4 histone [Pisaster brevispinus] emb|CAA33643.1| Histone protein [Caenorhabditis elegans] emb|CAA27581.1| unnamed protein product [Strongylocentrotus purpuratus] emb|CAA25241.1| unnamed protein product [Lytechinus pictus] gb|AAC48026.1| Histone protein 5 [Caenorhabditis elegans] ref|NP_509231.1| K03A1.6 [Caenorhabditis elegans] ref|NP_501406.1| HIStone family member (his-31) [Caenorhabditis elegans] ref|NP_496893.1| HIStone family member (his-10) [Caenorhabditis elegans] ref|NP_507034.1| HIStone family member (his-1) [Caenorhabditis elegans] ref|NP_492641.1| HIStone family member (his-67) [Caenorhabditis elegans] ref|NP_505466.1| HIStone family member (his-37) [Caenorhabditis elegans] ref|NP_505298.1| HIStone family member (his-18) [Caenorhabditis elegans] ref|NP_505291.1| HIStone family member (his-28) [Caenorhabditis elegans] ref|NP_505275.1| HIStone family member (his-50) [Caenorhabditis elegans] ref|NP_505200.1| HIStone family member (his-5) [Caenorhabditis elegans] ref|NP_502154.1| HIStone family member (his-64) [Caenorhabditis elegans] ref|NP_502139.1| HIStone family member (his-56) [Caenorhabditis elegans] ref|NP_502133.1| HIStone family member (his-46) [Caenorhabditis elegans] ref|NP_496896.1| HIStone family member (his-26) [Caenorhabditis elegans] ref|NP_496889.1| HIStone family member (his-14) [Caenorhabditis elegans] ref|XP_780884.1| PREDICTED: similar to histone (his-67) [Strongylocentrotus purpuratus] ref|XP_781796.1| PREDICTED: similar to histone (his-67) [Strongylocentrotus purpuratus] ref|NP_999707.1| H4 histone protein [Strongylocentrotus purpuratus] ref|NP_999716.1| late histone gene L1 H4 [Strongylocentrotus purpuratus] ref|NP_999715.1| late histone gene L2 H4 [Strongylocentrotus purpuratus] ref|NP_999713.1| late embryonic histone H4 [Strongylocentrotus purpuratus] sp|P62779|H4_PYCHE Histone H4 sp|P62778|H4_PISOC Histone H4 sp|P62777|H4_PISBR Histone H4 sp|P62780|H4_PARLI Histone H4 sp|P62782|H4_LYTPI Histone H4 sp|P62776|H4_HOLTU Histone H4 sp|P62784|H4_CAEEL Histone H4 emb|CAE60210.1| Hypothetical protein CBG03774 [Caenorhabditis briggsae] emb|CAE72198.1| Hypothetical protein CBG19306 [Caenorhabditis briggsae] emb|CAE62043.1| Hypothetical protein CBG06059 [Caenorhabditis briggsae] emb|CAE62040.1| Hypothetical protein CBG06056 [Caenorhabditis briggsae] emb|CAE61894.1| Hypothetical protein CBG05885 [Caenorhabditis briggsae] emb|CAE61864.1| Hypothetical protein CBG05842 [Caenorhabditis briggsae] emb|CAE61861.1| Hypothetical protein CBG05839 [Caenorhabditis briggsae] emb|CAE75444.1| Hypothetical protein CBG23438 [Caenorhabditis briggsae] emb|CAE58375.1| Hypothetical protein CBG01504 [Caenorhabditis briggsae] emb|CAE58373.1| Hypothetical protein CBG01500 [Caenorhabditis briggsae] gb|AAB48834.1| cleavage stage histone H4 [Psammechinus miliaris] pir||S01618 histone H4, embryonic (clones L1 and L2) - sea urchin (Strongylocentrotus purpuratus) emb|CAA86298.1| histone H4 [Holothuria tubulosa] emb|CAA29849.1| unnamed protein product [Strongylocentrotus purpuratus] emb|CAA29847.1| unnamed protein product [Strongylocentrotus purpuratus] emb|CAA76307.1| histone H4 [Paracentrotus lividus] emb|CAA25630.1| histone H4 (aa 1-103) [Psammechinus miliaris] sp|P62783|H4_STRPU Histone H4 sp|P62781|H4_PSAMI Histone H4 gb|AAA69664.1| histone gb|AAA30024.1| histone H4 gb|AAA30002.1| histone H4 prf||2209257B histone H4 7.0E-40
blast AAB00649 Histone protein 60 [Caenorhabditis elegans] ref|NP_501203.1| F55G1.11 [Caenorhabditis elegans] pir||T29230 hypothetical protein F55G1.11 - Caenorhabditis elegans 7.0E-40
blast HSUR4P histone H4, embryonic - sea urchin (Strongylocentrotus purpuratus) pir||HSUR4 histone H4 - sea urchin (Psammechinus miliaris) pir||S68537 histone H4 - starfish (Asterina pectinifera) gb|AAA30054.1| H4 histone protein 7.0E-40
Protein Domains
Database ID Description E-Value
Pfam IPR007125 EMBL-EBI Histone core 5.3E-13
Sequence
Target Sequence 
>C. ELEGANS:172733_X_AT
gaaaaggaggtgccaagcgccatcgcaaggtccttcgtgacaacatccaaggaatcacca
agccagctattcgccgtctcgctcgtcgtggtggagtcaagcgtatttctggactcatct
acgaggaaactcgtggagttctcaaggtgttcctcgagaacgtcatccgtgatgccgtca
cctactgtgagcacgccaagagaaagactgtcaccgccatggacgtcgtctatgctttga
agcgt

BLASTn GenBank NR
Probe Info
Probe Sequence(5'-3') Probe X Probe Y Probe Interrogation
Position 		Strandedness
GAAAAGGAGGTGCCAAGCGCCATCG 130 355 47 Antisense
CGCAAGGTCCTTCGTGACAACATCC 557 253 70 Antisense
AGGAATCACCAAGCCAGCTATTCGC 15 55 96 Antisense
CTCGCTCGTCGTGGTGGAGTCAAGC 673 233 124 Antisense
TCAAGCGTATTTCTGGACTCATCTA 147 631 143 Antisense
TGGAGTTCTCAAGGTGTTCCTCGAG 698 549 180 Antisense
CGAGAACGTCATCCGTGATGCCGTC 649 249 201 Antisense
TCACCTACTGTGAGCACGCCAAGAG 142 625 224 Antisense
AAGAGAAAGACTGTCACCGCCATGG 697 151 244 Antisense
CACCGCCATGGACGTCGTCTATGCT 134 201 258 Antisense
GGACGTCGTCTATGCTTTGAAGCGT 43 525 267 Antisense
Sequence Source Affymetrix Proprietary Database