[Home] | [Total List]

[172732_x_at] Histone

Description F55G1.2 /REP_DB=WormBase Gene ID /WP=CE03253 /TR=SW:P08898 /GB=AAB00650.1 /SUBMIT=ST.LOUIS /CHR=4 /FEA=Sanger Annotation /DEF=Histone
Cluster 6grp_high1_10_10 > 69      4grp_high_8_8 > 39      6grp_total > 79      4grp_total > 40      6grp_cgc > 29      6grp_high1_sub > Cu      6grp_cgc_sub > Cu      4grp_rule_based > L3      

Scale
G range Absolute graph Relative graph Expression Table Dauer Comp.
4 1386
1 2 3 4 range
A 1387.9
(-3)
A 		2217.8
(0.6)
P 		2773.5
(3)
P 		2271.5
(0.8)
P 		1386
B 1461.5
(-3)
P 		2249.2
(2.4)
P 		2336.2
(3)
P 		1981.1
(0.6)
P 		875
C 1388.5
(-3)
M 		2180.3
(2.2)
P 		2294.6
(3)
P 		2053.7
(1.4)
P 		906
avr 1412.6
(-3) 		2215.8
(1.6) 		2468.1
(3) 		2102.1
(0.9) 		1056

1 : 1 state (S1, L1)
2 : dauer (ST, LT)
6 961
1 2 3 4 5 6 range
A 997.1
(-3)
M 		1479.7
(0.7)
P 		1248.1
(-1.1)
P 		1419.3
(0.2)
P 		1307.9
(-0.6)
P 		1778.3
(3)
P 		781
B 1442.9
(-0.2)
P 		1603.5
(0.9)
P 		1208.4
(-1.8)
P 		1031.7
(-3)
P 		1664.4
(1.3)
P 		1917.7
(3)
P 		886
C 1272.8
(-1.9)
P 		1492.9
(-0.3)
P 		1327.6
(-1.5)
M 		1110.9
(-3)
P 		1614.9
(0.6)
P 		1957.9
(3)
P 		847
avr 1237.6
(-2.6) 		1525.4
(-0.1) 		1261.4
(-2.4) 		1187.3
(-3) 		1529.1
(-0.1) 		1884.6
(3) 		697
No Scale
G range Absolute graph Relative graph Expression Table Dauer Comp.
4 467
1 2 3 4 range
A 505.3
(-0.4)
A 		481.4
(-0.7)
P 		725
(3)
P 		332.5
(-3)
P 		393
B 466.1
(-1)
P 		555.5
(3)
P 		541.4
(2.4)
P 		422.2
(-3)
P 		133
C 459.6
(-1.5)
M 		626.9
(0.7)
P 		799.8
(3)
P 		346.3
(-3)
P 		454
avr 477
(-0.9) 		554.6
(0.5) 		688.7
(3) 		367
(-3) 		322

1 : 1 state (S1, L1)
2 : dauer (ST, LT)
6 531
1 2 3 4 5 6 range
A 183.8
(-3)
M 		526.3
(3)
P 		271.8
(-1.5)
P 		360
(0.1)
P 		394.7
(0.7)
P 		433
(1.4)
P 		343
B 502.1
(0.1)
P 		533.7
(0.5)
P 		293.4
(-2.7)
P 		273.3
(-3)
P 		676.2
(2.5)
P 		715.1
(3)
P 		442
C 471.8
(0.5)
P 		455.5
(0.2)
P 		337.9
(-1.4)
M 		223.4
(-3)
P 		522.6
(1.2)
P 		655.4
(3)
P 		432
avr 385.9
(-1.1) 		505.2
(1.2) 		301
(-2.7) 		285.6
(-3) 		531.2
(1.7) 		601.2
(3) 		316
NetAffx Links Cluster Members
Consensus/Exemplar
Group Members
GeneChip Array Information
Probe Set ID 172732_x_at
GeneChip Array C. elegans Genome Array
Organism Common Name Nematode
Probe Design Information
Transcript ID(Array Design) affy.Ce.9075
Sequence Type Exemplar sequence
Representative Public ID F55G1.2 NCBI
Target Description F55G1.2 /REP_DB=WormBase Gene ID /WP=CE03253 /TR=SW:P08898 /GB=AAB00650.1 /SUBMIT=ST.LOUIS /CHR=4 /FEA=Sanger Annotation /DEF=Histone
Cluster Evidence This cluster is supported by a Sanger Annotation.
Annotation Method Description
Annotation Description This probe set was annotated using the Matching Probes based pipeline to a RefSeq identifier using 1 transcript(s).
Annotation Grade This is a grade A annotation.
Annotation Transcript Cluster (# of Matching Probes) NM_068803(11)
Transcript Assignments
Representative
Transcript		 Description Matching Probes Related Probesets by Grade
NM_068803 NCBI Caenorhabditis elegans F55G1.2 (Histone) mRNA, complete cds. 11/11 None
SNAP00000005174 ENSEMBL cdna:SNAP chromosome:CEL140:IV:7488233:7488643:1 11/11 None
GENEFINDER00000005184 ENSEMBL cdna:GeneFinder chromosome:CEL140:IV:7488233:7488643:1 11/11 None
F55G1.2 ENSEMBL cdna:known chromosome:CEL140:IV:7488233:7488643:1 gene:F55G1.2 11/11 None
Annotation Notes
Cross Hybridizing mRNA Matched Probes Nature of Assignment Related Probesets by Grade
NM_069752 1/11 Cross Hyb Matching Probes A 
NM_065410 1/11 Cross Hyb Matching Probes A 
NM_076943 1/11 Cross Hyb Matching Probes A 
NM_064489 1/11 Cross Hyb Matching Probes A 
NM_064493 1/11 Cross Hyb Matching Probes A 
NM_064494 1/11 Cross Hyb Matching Probes A 
NM_074632 2/11 Cross Hyb Matching Probes A B 
NM_069733 1/11 Cross Hyb Matching Probes A 
NM_069006 3/11 Cross Hyb Matching Probes A B 
NM_064498 1/11 Cross Hyb Matching Probes A 
NM_069737 1/11 Cross Hyb Matching Probes A 
SNAP00000009815 1/11 Cross Hyb Matching Probes None
SNAP00000009819 1/11 Cross Hyb Matching Probes None
SNAP00000009820 1/11 Cross Hyb Matching Probes None
GENEFINDER00000009834 1/11 Cross Hyb Matching Probes None
GENEFINDER00000009837 1/11 Cross Hyb Matching Probes None
GENEFINDER00000009841 1/11 Cross Hyb Matching Probes None
SNAP00000034714 1/11 Cross Hyb Matching Probes None
GENEFINDER00000034724 1/11 Cross Hyb Matching Probes None
SNAP00000016640 1/11 Cross Hyb Matching Probes None
GENEFINDER00000016651 1/11 Cross Hyb Matching Probes None
SNAP00000000480 3/11 Cross Hyb Matching Probes None
GENEFINDER00000000500 3/11 Cross Hyb Matching Probes None
SNAP00000002621 1/11 Cross Hyb Matching Probes None
GENEFINDER00000002632 1/11 Cross Hyb Matching Probes None
SNAP00000028586 1/11 Cross Hyb Matching Probes None
GENEFINDER00000028598 1/11 Cross Hyb Matching Probes None
SNAP00000035840 1/11 Cross Hyb Matching Probes None
GENEFINDER00000035856 1/11 Cross Hyb Matching Probes None
SNAP00000027916 2/11 Cross Hyb Matching Probes None
GENEFINDER00000027930 2/11 Cross Hyb Matching Probes None
SNAP00000004147 1/11 Cross Hyb Matching Probes None
GENEFINDER00000004155 1/11 Cross Hyb Matching Probes None
GENEFINDER00000013875 1/11 Cross Hyb Matching Probes None
SNAP00000013868 2/11 Cross Hyb Matching Probes None
ZK131.7 1/11 Cross Hyb Matching Probes A 
ZK131.3 1/11 Cross Hyb Matching Probes A 
ZK131.2 1/11 Cross Hyb Matching Probes A 
F08G2.3 1/11 Cross Hyb Matching Probes A 
E03A3.3 1/11 Cross Hyb Matching Probes A 
F17E9.10 3/11 Cross Hyb Matching Probes A B 
B0035.10 1/11 Cross Hyb Matching Probes A 
F54E12.1 1/11 Cross Hyb Matching Probes A 
F22B3.2 1/11 Cross Hyb Matching Probes A 
T10C6.13 2/11 Cross Hyb Matching Probes A B 
K03A1.1 2/11 Cross Hyb Matching Probes B 
F45E1.6.1 1/11 Cross Hyb Matching Probes None
F45E1.6.2 1/11 Cross Hyb Matching Probes None
Genomic Alignment of Consensus/Exemplar Sequence
Assembly Wormbase March 2004
Alignment(s)
Position Identity Coverage Cytoband
chrII:13823541-13823952(+) 91.97 91.97
chrII:13820103-13820514(+) 91.97 91.97
chrIV:7488238-7488649(+) 100.0 100.0
chrIV:11326564-11326975(+) 95.38 95.38
chrIV:8334292-8334703(+) 94.16 94.16
chrII:13824742-13825153(-) 91.97 91.97
chrII:13828180-13828591(-) 91.73 91.73
chrIV:11406427-11406838(-) 95.38 95.38
chrIV:11337829-11338240(-) 95.38 95.38
Public Domain and Genome References
Gene Title Histone
Gene Symbol his-59
Ensembl F55G1.2
Entrez Gene 186325 Entrez gene
SwissProt P08898 EMBL-EBI
WormBase CE03253 Wormbase
Functional Annotations
Ortholog
ID Title Organism
ATH1-121501:262973_AT histone H3.2, putative at
ATH1-121501:262979_S_AT histone H3, putative at
HG-U133_PLUS_2:208506_AT histone 1, H3f hs
HG-U133A:208506_AT histone 1, H3f hs
HG-FOCUS:208506_AT histone 1, H3f hs
HG-U133A_2:208506_AT histone 1, H3f hs
U133_X3P:G10440559_3P_AT histone 1, H3f hs
MOE430A:1460314_S_AT histone 1, H3f mm
MOUSE430_2:1460314_S_AT histone 1, H3f mm
MOUSE430A_2:1460314_S_AT histone 1, H3f mm
MG-U74AV2:96416_F_AT histone 1, H3f mm
MG-U74AV2:93022_I_AT histone 1, H3f mm
MG-U74AV2:93023_F_AT histone 1, H3f mm
MOE430A:1431231_AT histone 1, H3f mm
MOUSE430A_2:1431231_AT histone 1, H3f mm
MOUSE430_2:1431231_AT histone 1, H3f mm
MOE430A:1460314_S_AT histone1, H3c mm
MOUSE430_2:1460314_S_AT histone1, H3c mm
MOUSE430A_2:1460314_S_AT histone1, H3c mm
MG-U74AV2:93023_F_AT histone1, H3c mm
MOE430A:1460314_S_AT histone1, H3d mm
MOUSE430_2:1460314_S_AT histone1, H3d mm
MOUSE430A_2:1460314_S_AT histone1, H3d mm
MG-U74AV2:94756_AT histone1, H3d mm
MOUSE430A_2:1427864_AT histone1, H3d mm
MOE430A:1427864_AT histone1, H3d mm
MOUSE430_2:1427864_AT histone1, H3d mm
MU11KSUBA:M32461_S_AT histone1, H3d mm
MG-U74AV2:96416_F_AT histone1, H3d mm
MG-U74AV2:93023_F_AT histone1, H3d mm
MOE430A:1453573_AT histone1, H3d mm
MOUSE430A_2:1453573_AT histone1, H3d mm
MOUSE430_2:1453573_AT histone1, H3d mm
MOE430A:1431231_AT histone1, H3d mm
MOUSE430A_2:1431231_AT histone1, H3d mm
MOUSE430_2:1431231_AT histone1, H3d mm
MOUSE430_2:1427863_AT histone1, H3d mm
MOUSE430A_2:1427863_AT histone1, H3d mm
MOE430A:1427863_AT histone1, H3d mm
MOE430A:1460314_S_AT histone 1, H3b mm
MOUSE430_2:1460314_S_AT histone 1, H3b mm
MOUSE430A_2:1460314_S_AT histone 1, H3b mm
MG-U74AV2:94756_AT histone 1, H3b mm
MOUSE430A_2:1427864_AT histone 1, H3b mm
MOE430A:1427864_AT histone 1, H3b mm
MOUSE430_2:1427864_AT histone 1, H3b mm
MU11KSUBA:M32461_S_AT histone 1, H3b mm
MG-U74AV2:93023_F_AT histone 1, H3b mm
MOE430A:1431231_AT histone 1, H3b mm
MOUSE430A_2:1431231_AT histone 1, H3b mm
MOUSE430_2:1431231_AT histone 1, H3b mm
MOE430A:1460314_S_AT histone 1, H3e mm
MOUSE430_2:1460314_S_AT histone 1, H3e mm
MOUSE430A_2:1460314_S_AT histone 1, H3e mm
MG-U74AV2:94756_AT histone 1, H3e mm
MOUSE430A_2:1427864_AT histone 1, H3e mm
MOE430A:1427864_AT histone 1, H3e mm
MOUSE430_2:1427864_AT histone 1, H3e mm
MU11KSUBA:M32461_S_AT histone 1, H3e mm
MG-U74AV2:96416_F_AT histone 1, H3e mm
MG-U74AV2:93023_F_AT histone 1, H3e mm
MOE430A:1431231_AT histone 1, H3e mm
MOUSE430A_2:1431231_AT histone 1, H3e mm
MOUSE430_2:1431231_AT histone 1, H3e mm
MU19KSUBB:TC30298_AT Histone1, H3c (Hist1h3c), mRNA mm
RG-U34A:RC_AI045794_AT histone 1, H4a (predicted) rn
RG-U34C:RC_AI137974_F_AT histone 1, H4a (predicted) rn
RG-U34C:RC_AI137974_I_AT histone 1, H4a (predicted) rn
RAE230A:1388276_AT histone 1, H4a (predicted) rn
RAT230_2:1388276_AT histone 1, H4a (predicted) rn
RAE230A:1371332_AT Histone 1, H4a (predicted) rn
RAT230_2:1371332_AT Histone 1, H4a (predicted) rn
RG-U34C:RC_AI178475_AT Histone 1, H4a (predicted) rn
Gene Ontology
GO Biological Process (view graph)
ID Description Evidence Links
6334 nucleosome assembly inferred from electronic annotation QuickGO AmiGO
7001 chromosome organization and biogenesis (sensu Eukaryota) inferred from electronic annotation QuickGO AmiGO
GO Cellular Component (view graph)
ID Description Evidence Links
786 nucleosome inferred from electronic annotation QuickGO AmiGO
5634 nucleus inferred from electronic annotation QuickGO AmiGO
GO Molecular Function (view graph)
ID Description Evidence Links
3677 DNA binding inferred from electronic annotation QuickGO AmiGO
Protein Similarities
Method ID Description E-Value
blast CAB05834 Hypothetical protein ZK131.7 [Caenorhabditis elegans] emb|CAB05833.1| Hypothetical protein ZK131.3 [Caenorhabditis elegans] emb|CAB05831.1| Hypothetical protein ZK131.2 [Caenorhabditis elegans] emb|CAA97411.1| Hypothetical protein B0035.10 [Caenorhabditis elegans] emb|CAA92733.1| Hypothetical protein F22B3.2 [Caenorhabditis elegans] emb|CAB07653.1| Hypothetical protein T10C6.13 [Caenorhabditis elegans] emb|CAB05209.1| Hypothetical protein F54E12.1 [Caenorhabditis elegans] emb|CAB04057.1| Hypothetical protein F08G2.3 [Caenorhabditis elegans] gb|AAC05102.1| Histone protein 32 [Caenorhabditis elegans] gb|AAK84514.1| Histone protein 49 [Caenorhabditis elegans] gb|AAF98226.1| Histone protein 17 [Caenorhabditis elegans] gb|AAF98231.1| Histone protein 27 [Caenorhabditis elegans] emb|CAA33644.1| Histone protein [Caenorhabditis elegans] gb|AAB00650.1| Histone protein 59 [Caenorhabditis elegans] gb|AAC48033.1| Histone protein 6 [Caenorhabditis elegans] ref|NP_505292.1| HIStone family member (his-27) [Caenorhabditis elegans] ref|NP_505297.1| HIStone family member (his-17) [Caenorhabditis elegans] ref|NP_496890.1| HIStone family member (his-13) [Caenorhabditis elegans] ref|NP_505199.1| HIStone family member (his-6) [Caenorhabditis elegans] ref|NP_501204.1| F55G1.2 [Caenorhabditis elegans] ref|NP_502138.1| HIStone family member (his-55) [Caenorhabditis elegans] ref|NP_502153.1| HIStone family member (his-63) [Caenorhabditis elegans] ref|NP_496899.1| HIStone family member (his-42) [Caenorhabditis elegans] ref|NP_505276.1| HIStone family member (his-49) [Caenorhabditis elegans] ref|NP_502134.1| HIStone family member (his-45) [Caenorhabditis elegans] ref|NP_507033.1| HIStone family member (his-2) [Caenorhabditis elegans] ref|NP_501407.1| HIStone family member (his-32) [Caenorhabditis elegans] ref|NP_496895.1| HIStone family member (his-25) [Caenorhabditis elegans] ref|NP_496894.1| HIStone family member (his-9) [Caenorhabditis elegans] gb|AAG50235.1| histone H3 [Caenorhabditis elegans] pir||HSKW3 histone H3 - Caenorhabditis elegans 5.0E-70
blast P08898 Histone H3 1.0E-69
blast AAH74969 H3/o protein [Homo sapiens] 2.0E-68
Protein Domains
Database ID Description E-Value
Pfam IPR007125 EMBL-EBI Histone core 1.6E-29
Sequence
Target Sequence 
>C. ELEGANS:172732_X_AT
agcaattggccaccaaagctgctcgcaagtcggccccagcttcaggaggagtcaagaagc
cacatcgttatcgtccaggaaccgtcgctctccgtgagatcagacgttaccaaaaatcca
ccgaacttcttatccgcagagctccattccagcgccttgtccgtgagattgctcaggatt
tcaagactgatcttcgattccaatcttccgctgtcatggctcttcaagaggctgccgagg
cttaccttgtcggactcttcgaggacaccaacttgtgcgccatccacgctaagcgagtca
ccattatgccaa

BLASTn GenBank NR
Probe Info
Probe Sequence(5'-3') Probe X Probe Y Probe Interrogation
Position 		Strandedness
AGCAATTGGCCACCAAAGCTGCTCG 59 77 68 Antisense
GCCCCAGCTTCAGGAGGAGTCAAGA 381 285 100 Antisense
GGAGTCAAGAAGCCACATCGTTATC 207 517 115 Antisense
CATCGTTATCGTCCAGGAACCGTCG 613 209 130 Antisense
CCGTCGCTCTCCGTGAGATCAGACG 534 265 149 Antisense
CGCCTTGTCCGTGAGATTGCTCAGG 551 257 220 Antisense
GACTGATCTTCGATTCCAATCTTCC 482 375 252 Antisense
GGCTCTTCAAGAGGCTGCCGAGGCT 402 539 285 Antisense
TTACCTTGTCGGACTCTTCGAGGAC 553 681 309 Antisense
TTCGAGGACACCAACTTGTGCGCCA 675 695 325 Antisense
GCTAAGCGAGTCACCATTATGCCAA 144 303 355 Antisense
Sequence Source Affymetrix Proprietary Database