[Home] | [Total List]

[172700_x_at] collagen

Description T11F9.9 /REP_DB=WormBase Gene ID /WP=CE06421 /TR=Q22393 /GB=CAA98525.1 /SUBMIT=HINXTON /CHR=5 /FEA=Sanger Annotation /DEF=collagen
Cluster 6grp_highest_10_10 > 26      6grp_high1_10_10 > 42      4grp_highest_8_8 > 09      4grp_high_8_8 > 53      6grp_highest_nonorm > 07      6grp_total > 62      4grp_total > 58      6grp_highest_sub > 03      6grp_cgc > 73      6grp_high1_sub > 02_03      6grp_cgc_sub > 02_03      6grp_total_sub > Hat      6grp_rule_based > S3      4grp_rule_based > L3      

Scale
G range Absolute graph Relative graph Expression Table Dauer Comp.
4 22974
1 2 3 4 range
A 8292
(-1.2)
P 		20184.8
(1.9)
P 		24222.5
(3)
P 		1435
(-3)
P 		22788
B 8674
(-0.9)
P 		18306.5
(2)
P 		21896.3
(3)
P 		1298.7
(-3)
P 		20598
C 8005.6
(-0.5)
P 		17617.1
(3)
P 		17647.9
(3)
P 		1248.5
(-3)
P 		16399
avr 8323.9
(-0.9) 		18702.8
(2.2) 		21255.6
(3) 		1327.4
(-3) 		19928

1 : 1 state (S1, L1)
2 : dauer (ST, LT)
6 9906
1 2 3 4 5 6 range
A 8979.8
(-2.8)
P 		14844.6
(1.5)
P 		16833.8
(3)
P 		14463.7
(1.2)
P 		12403.8
(-0.3)
P 		8726.5
(-3)
P 		8107
B 9937.4
(-1.9)
P 		14248.6
(1.3)
P 		16586.3
(3)
P 		13971.8
(1.1)
P 		11481.2
(-0.8)
P 		8460.9
(-3)
P 		8125
C 8298.9
(-2.1)
P 		14986
(2.6)
P 		15634.4
(3)
P 		12388.6
(0.8)
P 		13953.4
(1.8)
P 		6927.6
(-3)
P 		8707
avr 9072
(-2.3) 		14693.1
(1.8) 		16351.5
(3) 		13608
(1) 		12612.8
(0.3) 		8038.3
(-3) 		8313
No Scale
G range Absolute graph Relative graph Expression Table Dauer Comp.
4 6122
1 2 3 4 range
A 3019.1
(-0.2)
P 		4381.6
(1.1)
P 		6332.2
(3)
P 		210.1
(-3)
P 		6122
B 2766.1
(0.1)
P 		4521.3
(2.3)
P 		5073.9
(3)
P 		276.7
(-3)
P 		4797
C 2650.1
(-0.5)
P 		5065
(1.9)
P 		6150.8
(3)
P 		210.5
(-3)
P 		5940
avr 2811.8
(-0.2) 		4656
(1.7) 		5852.3
(3) 		232.4
(-3) 		5620

1 : 1 state (S1, L1)
2 : dauer (ST, LT)
6 3624
1 2 3 4 5 6 range
A 1655.4
(-3)
P 		5279.5
(3)
P 		3666.1
(0.3)
P 		3668.3
(0.3)
P 		3742.9
(0.5)
P 		2124.6
(-2.2)
P 		3624
B 3457.7
(-1.9)
P 		4742.8
(3)
P 		4027.6
(0.3)
P 		3700.6
(-0.9)
P 		4664.6
(2.7)
P 		3155
(-3)
P 		1588
C 3076
(-1)
P 		4572.7
(3)
P 		3979.2
(1.4)
P 		2491.4
(-2.5)
P 		4515.1
(2.8)
P 		2319.1
(-3)
P 		2254
avr 2729.7
(-2.5) 		4865
(3) 		3891
(0.5) 		3286.8
(-1.1) 		4307.5
(1.6) 		2532.9
(-3) 		2332
NetAffx Links Cluster Members
Consensus/Exemplar
Group Members
GeneChip Array Information
Probe Set ID 172700_x_at
GeneChip Array C. elegans Genome Array
Organism Common Name Nematode
Probe Design Information
Transcript ID(Array Design) affy.Ce.14106
Sequence Type Exemplar sequence
Representative Public ID T11F9.9 NCBI
Target Description T11F9.9 /REP_DB=WormBase Gene ID /WP=CE06421 /TR=Q22393 /GB=CAA98525.1 /SUBMIT=HINXTON /CHR=5 /FEA=Sanger Annotation /DEF=collagen
Cluster Evidence This cluster is supported by a Sanger Annotation.
Annotation Method Description
Annotation Description This probe set was annotated using the Matching Probes based pipeline to a RefSeq identifier using 1 transcript(s).
Annotation Grade This is a grade A annotation.
Annotation Transcript Cluster (# of Matching Probes) NM_073512(11)
Transcript Assignments
Representative
Transcript		 Description Matching Probes Related Probesets by Grade
NM_073512 NCBI Caenorhabditis elegans T11F9.9 (collagen) mRNA, complete cds. 11/11 None
SNAP00000013927 ENSEMBL cdna:SNAP chromosome:CEL140:V:11486642:11487586:1 11/11 None
GENEFINDER00000013944 ENSEMBL cdna:GeneFinder chromosome:CEL140:V:11486642:11487586:1 11/11 None
T11F9.9 ENSEMBL cdna:known chromosome:CEL140:V:11486642:11487586:1 gene:T11F9.9 11/11 None
Annotation Notes
Cross Hybridizing mRNA Matched Probes Nature of Assignment Related Probesets by Grade
NM_061259 1/11 Cross Hyb Matching Probes A 
NM_069466 1/11 Cross Hyb Matching Probes A 
NM_067504 1/11 Cross Hyb Matching Probes A 
NM_073485 7/11 Cross Hyb Matching Probes A 
NM_073487 6/11 Cross Hyb Matching Probes A 
NM_069125 1/11 Cross Hyb Matching Probes A 
NM_069126 1/11 Cross Hyb Matching Probes A 
NM_071851 1/11 Cross Hyb Matching Probes None
NM_072337 2/11 Cross Hyb Matching Probes A 
NM_072973 1/11 Cross Hyb Matching Probes A 
NM_072974 1/11 Cross Hyb Matching Probes None
NM_072975 1/11 Cross Hyb Matching Probes None
NM_070299 2/11 Cross Hyb Matching Probes A 
NM_062479 1/11 Cross Hyb Matching Probes A 
NM_067302 1/11 Cross Hyb Matching Probes A 
NM_073882 1/11 Cross Hyb Matching Probes A 
NM_058794 1/11 Cross Hyb Matching Probes None
NM_073501 1/11 Cross Hyb Matching Probes A 
NM_069299 1/11 Cross Hyb Matching Probes A 
NM_072335 2/11 Cross Hyb Matching Probes A 
NM_069706 1/11 Cross Hyb Matching Probes A 
NM_068118 1/11 Cross Hyb Matching Probes A 
NM_077154 1/11 Cross Hyb Matching Probes None
NM_067737 2/11 Cross Hyb Matching Probes A 
NM_072124 1/11 Cross Hyb Matching Probes A 
NM_069777 1/11 Cross Hyb Matching Probes A 
NM_063908 1/11 Cross Hyb Matching Probes A 
NM_062477 1/11 Cross Hyb Matching Probes None
NM_073652 1/11 Cross Hyb Matching Probes A 
SNAP00000038907 1/11 Cross Hyb Matching Probes None
GENEFINDER00000038912 1/11 Cross Hyb Matching Probes None
SNAP00000005486 1/11 Cross Hyb Matching Probes None
GENEFINDER00000005502 1/11 Cross Hyb Matching Probes None
SNAP00000014220 1/11 Cross Hyb Matching Probes None
SNAP00000014221 1/11 Cross Hyb Matching Probes None
GENEFINDER00000014231 1/11 Cross Hyb Matching Probes None
GENEFINDER00000014237 1/11 Cross Hyb Matching Probes None
SNAP00000020968 1/11 Cross Hyb Matching Probes None
GENEFINDER00000020971 1/11 Cross Hyb Matching Probes None
SNAP00000026473 1/11 Cross Hyb Matching Probes None
GENEFINDER00000026484 1/11 Cross Hyb Matching Probes None
SNAP00000034887 1/11 Cross Hyb Matching Probes None
SNAP00000000290 1/11 Cross Hyb Matching Probes None
GENEFINDER00000000294 1/11 Cross Hyb Matching Probes None
SNAP00000005654 1/11 Cross Hyb Matching Probes None
SNAP00000005655 1/11 Cross Hyb Matching Probes None
GENEFINDER00000005663 1/11 Cross Hyb Matching Probes None
GENEFINDER00000005664 1/11 Cross Hyb Matching Probes None
SNAP00000015232 1/11 Cross Hyb Matching Probes None
GENEFINDER00000015234 1/11 Cross Hyb Matching Probes None
SNAP00000017748 2/11 Cross Hyb Matching Probes None
GENEFINDER00000017752 2/11 Cross Hyb Matching Probes None
SNAP00000023158 1/11 Cross Hyb Matching Probes None
GENEFINDER00000023159 1/11 Cross Hyb Matching Probes None
SNAP00000024853 1/11 Cross Hyb Matching Probes None
GENEFINDER00000024861 1/11 Cross Hyb Matching Probes None
SNAP00000033943 1/11 Cross Hyb Matching Probes None
GENEFINDER00000033946 2/11 Cross Hyb Matching Probes None
SNAP00000035582 2/11 Cross Hyb Matching Probes None
GENEFINDER00000035589 2/11 Cross Hyb Matching Probes None
SNAP00000037122 1/11 Cross Hyb Matching Probes None
GENEFINDER00000037126 1/11 Cross Hyb Matching Probes None
SNAP00000043526 1/11 Cross Hyb Matching Probes None
GENEFINDER00000043530 1/11 Cross Hyb Matching Probes None
SNAP00000007006 1/11 Cross Hyb Matching Probes None
GENEFINDER00000007015 1/11 Cross Hyb Matching Probes None
SNAP00000007051 1/11 Cross Hyb Matching Probes None
GENEFINDER00000007058 1/11 Cross Hyb Matching Probes None
SNAP00000017929 7/11 Cross Hyb Matching Probes None
SNAP00000017931 6/11 Cross Hyb Matching Probes None
GENEFINDER00000017933 7/11 Cross Hyb Matching Probes None
SNAP00000018332 1/11 Cross Hyb Matching Probes None
GENEFINDER00000018334 1/11 Cross Hyb Matching Probes None
GENEFINDER00000023019 1/11 Cross Hyb Matching Probes None
SNAP00000023063 1/11 Cross Hyb Matching Probes None
GENEFINDER00000023069 1/11 Cross Hyb Matching Probes None
SNAP00000035388 2/11 Cross Hyb Matching Probes None
SNAP00000035390 2/11 Cross Hyb Matching Probes None
GENEFINDER00000035395 2/11 Cross Hyb Matching Probes None
GENEFINDER00000035407 2/11 Cross Hyb Matching Probes None
SNAP00000039737 1/11 Cross Hyb Matching Probes None
SNAP00000041958 1/11 Cross Hyb Matching Probes None
T28F2.8 1/11 Cross Hyb Matching Probes A 
C50D2.4 1/11 Cross Hyb Matching Probes A 
F11G11.11.1 1/11 Cross Hyb Matching Probes A 
F11G11.12 1/11 Cross Hyb Matching Probes A 
C09G5.4 1/11 Cross Hyb Matching Probes A 
F14F7.1.2 1/11 Cross Hyb Matching Probes A 
F14F7.1.1 1/11 Cross Hyb Matching Probes A 
F14F7.1.3 1/11 Cross Hyb Matching Probes A 
K02D7.3 1/11 Cross Hyb Matching Probes A 
Y38C1BA.3 1/11 Cross Hyb Matching Probes R A 
F30B5.1 1/11 Cross Hyb Matching Probes A 
T28C6.4 1/11 Cross Hyb Matching Probes A 
T28C6.6 1/11 Cross Hyb Matching Probes A 
T05A1.2 1/11 Cross Hyb Matching Probes A 
C24F3.6 1/11 Cross Hyb Matching Probes None
C29F4.1.2 1/11 Cross Hyb Matching Probes None
C29F4.1.1 1/11 Cross Hyb Matching Probes None
F12F6.6 1/11 Cross Hyb Matching Probes None
F52B11.4 2/11 Cross Hyb Matching Probes A 
F41F3.4 1/11 Cross Hyb Matching Probes A 
F26F12.1 1/11 Cross Hyb Matching Probes A 
T15B7.4 2/11 Cross Hyb Matching Probes A 
T15B7.3 2/11 Cross Hyb Matching Probes A 
B0222.6 1/11 Cross Hyb Matching Probes A 
B0222.7 1/11 Cross Hyb Matching Probes A 
B0222.8 1/11 Cross Hyb Matching Probes A 
F55C10.2 7/11 Cross Hyb Matching Probes A 
F55C10.3 6/11 Cross Hyb Matching Probes A 
F57B7.3 1/11 Cross Hyb Matching Probes A 
ZK863.2 1/11 Cross Hyb Matching Probes A 
F57B1.3 1/11 Cross Hyb Matching Probes A 
C35B8.1 1/11 Cross Hyb Matching Probes A 
Genomic Alignment of Consensus/Exemplar Sequence
Assembly Wormbase March 2004
Alignment(s)
Position Identity Coverage Cytoband
chrV:11486641-11487586(+) 95.0 100.0
chrV:11387964-11388931(+) 97.0 97.0
chrV:11391477-11392444(-) 92.22 96.33
Public Domain and Genome References
Gene Title collagen
Gene Symbol col-157
Ensembl T11F9.9
Entrez Gene 188426 Entrez gene
SwissProt Q22393 EMBL-EBI
WormBase CE06421 Wormbase
Functional Annotations
Gene Ontology
GO Biological Process (view graph)
ID Description Evidence Links
6817 phosphate transport inferred from electronic annotation QuickGO AmiGO
GO Cellular Component (view graph)
ID Description Evidence Links
5737 cytoplasm inferred from electronic annotation QuickGO AmiGO
GO Molecular Function (view graph)
ID Description Evidence Links
42302 structural constituent of cuticle inferred from electronic annotation QuickGO AmiGO
Protein Similarities
Method ID Description E-Value
blast CAA98525 Hypothetical protein T11F9.9 [Caenorhabditis elegans] ref|NP_505913.1| T11F9.9 [Caenorhabditis elegans] 5.0E-34
blast CAE75258 Hypothetical protein CBG23219 [Caenorhabditis briggsae] 1.0E-33
blast CAE75236 Hypothetical protein CBG23187 [Caenorhabditis briggsae] 1.0E-33
Protein Domains
Database ID Description E-Value
Pfam IPR002486 EMBL-EBI Nematode cuticle collagen, N-terminal 6.4E-8
Pfam IPR008160 EMBL-EBI Collagen triple helix repeat 2.6E-10
Pfam IPR008160 EMBL-EBI Collagen triple helix repeat 1.2E-13
Trans Membrane
ID Number Of Domains Domain Boundaries
NP_505913.1 1 12-34
T11F9.9 1 12-34
SNAP00000013927 1 12-34
GENEFINDER00000013944 1 12-34
Sequence
Target Sequence 
>C. ELEGANS:172700_X_AT
ggaggatgtgatgcttgctgcttgccaggagctgctggaccagctggaacaccaggaaag
ccaggacgtccaggaaagccaggagcaccaggacttccaggaaacccgggacgcccacca
cagcaaccatgtgacccaatcactccaccaccatgccaaccatgcccacaaggaccacca
ggaccaccaggaccaccaggaccatcaggagatgctggaagcaacggaaacccaggatcc
ccaggacaagatggacaaccaggagcaccaggaaacaagggtccatctggacaaaatgga
aacccaggagctccaggagcaccaggacaaccagggcaagatgcaccatccgagccaatt
actccaggagctccaggaccacaaggagccccaggaccacaagggccaccaggacagcca
ggacaaccagg

BLASTn GenBank NR
Probe Info
Probe Sequence(5'-3') Probe X Probe Y Probe Interrogation
Position 		Strandedness
GGAGGATGTGATGCTTGCTGCTTGC 27 517 292 Antisense
TGCTGCTTGCCAGGAGCTGCTGGAC 454 581 307 Antisense
GCTGCTGGACCAGCTGGAACACCAG 520 297 322 Antisense
GAAAGCCAGGAGCACCAGGACTTCC 322 359 365 Antisense
GGACCACCAGGACCATCAGGAGATG 371 523 481 Antisense
GAGCACCAGGAAACAAGGGTCCATC 652 389 554 Antisense
GAAACCCAGGAGCTCCAGGAGCACC 661 355 590 Antisense
CAACCAGGGCAAGATGCACCATCCG 222 187 619 Antisense
CATCCGAGCCAATTACTCCAGGAGC 491 201 638 Antisense
TCCAGGAGCTCCAGGACCACAAGGA 479 589 654 Antisense
CACCAGGACAGCCAGGACAACCAGG 170 201 698 Antisense
Sequence Source Affymetrix Proprietary Database