[Home] | [Total List]

[172687_x_at]

Description F09C12.7 /REP_DB=WormBase Gene ID /WP=CE02603 /GEN=msp-74ps /GB=AAA68346.1 /SUBMIT=ST.LOUIS /CHR=2 /FEA=Sanger Annotation
Cluster 6grp_total > 98      4grp_total > 19      6grp_cgc > 79      6grp_cgc_sub > Da      6grp_total_sub > Increase      6grp_rule_based > S6      

Scale
G range Absolute graph Relative graph Expression Table Dauer Comp.
4 231
1 2 3 4 range
A 75.3
(-1.9)
A 		139.2
(3)
A 		61.1
(-3)
A 		128.5
(2.2)
A 		78
B 73.3
(-0.7)
A 		57.3
(-1.4)
A 		21.3
(-3)
A 		155.8
(3)
P 		135
C 68.1
(-2.6)
A 		67.6
(-2.6)
A 		55.2
(-3)
A 		252.7
(3)
P 		198
avr 72.2
(-1.8) 		88
(-1.1) 		45.9
(-3) 		179
(3) 		133

1 : 1 state (S1, L1)
2 : dauer (ST, LT)
6 2598
1 2 3 4 5 6 range
A 54.9
(-3)
A 		79.2
(-2.9)
M 		49.8
(-3)
A 		196.1
(-2.6)
P 		1604.1
(1)
P 		2354.8
(3)
P 		2305
B 49.5
(-3)
A 		61.5
(-3)
P 		108.5
(-2.9)
P 		214.4
(-2.6)
P 		2015.5
(1.6)
P 		2613.7
(3)
P 		2564
C 15.6
(-3)
A 		109.7
(-2.8)
P 		42.3
(-2.9)
A 		205.3
(-2.5)
P 		2417.1
(3)
P 		2156.7
(2.3)
P 		2402
avr 40
(-3) 		83.5
(-2.9) 		66.9
(-2.9) 		205.3
(-2.6) 		2012.2
(2.1) 		2375.1
(3) 		2335
No Scale
G range Absolute graph Relative graph Expression Table Dauer Comp.
4 38
1 2 3 4 range
A 27.4
(1.8)
A 		30.2
(3)
A 		16
(-3)
A 		18.8
(-1.8)
A 		14
B 23.4
(0.9)
A 		14.2
(-1)
A 		4.9
(-3)
A 		33.2
(3)
P 		28
C 22.5
(-2.2)
A 		19.4
(-2.9)
A 		19.2
(-3)
A 		42.6
(3)
P 		23
avr 24.4
(0.6) 		21.3
(-0.4) 		13.4
(-3) 		31.5
(3) 		18

1 : 1 state (S1, L1)
2 : dauer (ST, LT)
6 969
1 2 3 4 5 6 range
A 10.1
(-3)
A 		28.2
(-2.8)
M 		10.8
(-3)
A 		49.7
(-2.6)
P 		484
(2)
P 		573.3
(3)
P 		563
B 17.2
(-3)
A 		20.5
(-3)
P 		26.4
(-2.9)
P 		56.8
(-2.8)
P 		818.9
(2)
P 		974.6
(3)
P 		957
C 5.8
(-3)
A 		33.5
(-2.8)
P 		10.8
(-3)
A 		41.3
(-2.7)
P 		782.1
(3)
P 		722
(2.5)
P 		776
avr 11
(-3) 		27.4
(-2.9) 		16
(-3) 		49.3
(-2.7) 		695
(2.5) 		756.6
(3) 		746
NetAffx Links Cluster Members
Consensus/Exemplar
Group Members
GeneChip Array Information
Probe Set ID 172687_x_at
GeneChip Array C. elegans Genome Array
Organism Common Name Nematode
Probe Design Information
Transcript ID(Array Design) affy.Ce.5684
Sequence Type Exemplar sequence
Representative Public ID F09C12.7 NCBI
Target Description F09C12.7 /REP_DB=WormBase Gene ID /WP=CE02603 /GEN=msp-74ps /GB=AAA68346.1 /SUBMIT=ST.LOUIS /CHR=2 /FEA=Sanger Annotation
Annotation Method Description
Annotation Description This probe set was annotated using the Matching Probes based pipeline to a RefSeq identifier using 1 transcript(s).
Annotation Grade This is a grade A annotation.
Annotation Transcript Cluster (# of Matching Probes) NM_062548(11)
Transcript Assignments
Representative
Transcript		 Description Matching Probes Related Probesets by Grade
NM_062548 NCBI Caenorhabditis elegans Major Sperm Protein family member (msp-74) (msp-74) mRNA, complete cds. 11/11 None
SNAP00000009139 ENSEMBL cdna:SNAP chromosome:CEL140:II:5115084:5115317:-1 11/11 None
GENEFINDER00000009155 ENSEMBL cdna:GeneFinder chromosome:CEL140:II:5114522:5115317:-1 10/11 None
F09C12.7 ENSEMBL cdna:known chromosome:CEL140:II:5115084:5115317:-1 gene:F09C12.7 11/11 None
Annotation Notes
Cross Hybridizing mRNA Matched Probes Nature of Assignment Related Probesets by Grade
NM_062487 2/11 Cross Hyb Matching Probes A 
NM_069433 1/11 Cross Hyb Matching Probes A 
NM_062497 2/11 Cross Hyb Matching Probes A 
NM_068370 2/11 Cross Hyb Matching Probes A 
NM_069448 2/11 Cross Hyb Matching Probes A 
NM_068310 2/11 Cross Hyb Matching Probes A 
NM_068312 2/11 Cross Hyb Matching Probes A 
NM_068313 2/11 Cross Hyb Matching Probes A 
NM_069063 1/11 Cross Hyb Matching Probes A 
NM_062558 2/11 Cross Hyb Matching Probes A 
NM_062559 2/11 Cross Hyb Matching Probes A 
NM_062569 3/11 Cross Hyb Matching Probes A 
NM_062571 1/11 Cross Hyb Matching Probes A 
NM_068351 2/11 Cross Hyb Matching Probes A 
NM_068354 2/11 Cross Hyb Matching Probes A 
NM_062505 1/11 Cross Hyb Matching Probes A 
NM_068359 2/11 Cross Hyb Matching Probes A 
NM_068377 2/11 Cross Hyb Matching Probes A 
NM_068379 2/11 Cross Hyb Matching Probes A 
NM_062490 1/11 Cross Hyb Matching Probes A 
NM_062500 1/11 Cross Hyb Matching Probes A 
NM_062742 1/11 Cross Hyb Matching Probes A 
NM_062743 1/11 Cross Hyb Matching Probes A 
NM_062748 1/11 Cross Hyb Matching Probes A 
NM_062753 1/11 Cross Hyb Matching Probes A 
NM_069321 1/11 Cross Hyb Matching Probes A 
NM_069339 1/11 Cross Hyb Matching Probes A 
NM_069341 1/11 Cross Hyb Matching Probes A 
NM_069358 1/11 Cross Hyb Matching Probes A 
NM_069359 1/11 Cross Hyb Matching Probes A 
NM_069361 1/11 Cross Hyb Matching Probes A 
NM_069380 1/11 Cross Hyb Matching Probes A 
NM_062457 2/11 Cross Hyb Matching Probes A 
NM_062764 1/11 Cross Hyb Matching Probes A 
NM_062464 2/11 Cross Hyb Matching Probes A 
NM_068372 2/11 Cross Hyb Matching Probes A 
SNAP00000024816 1/11 Cross Hyb Matching Probes None
GENEFINDER00000024829 1/11 Cross Hyb Matching Probes None
SNAP00000000807 2/11 Cross Hyb Matching Probes None
SNAP00000000808 4/11 Cross Hyb Matching Probes None
GENEFINDER00000000821 2/11 Cross Hyb Matching Probes None
GENEFINDER00000000824 4/11 Cross Hyb Matching Probes None
SNAP00000007649 1/11 Cross Hyb Matching Probes None
GENEFINDER00000007652 1/11 Cross Hyb Matching Probes None
SNAP00000016470 2/11 Cross Hyb Matching Probes None
GENEFINDER00000016484 2/11 Cross Hyb Matching Probes None
SNAP00000019951 2/11 Cross Hyb Matching Probes None
SNAP00000019952 2/11 Cross Hyb Matching Probes None
GENEFINDER00000019958 1/11 Cross Hyb Matching Probes None
GENEFINDER00000019959 2/11 Cross Hyb Matching Probes None
SNAP00000021327 3/11 Cross Hyb Matching Probes None
SNAP00000021329 1/11 Cross Hyb Matching Probes None
GENEFINDER00000021346 1/11 Cross Hyb Matching Probes None
GENEFINDER00000021348 3/11 Cross Hyb Matching Probes None
SNAP00000031244 1/11 Cross Hyb Matching Probes None
SNAP00000031245 1/11 Cross Hyb Matching Probes None
GENEFINDER00000031253 1/11 Cross Hyb Matching Probes None
GENEFINDER00000031258 1/11 Cross Hyb Matching Probes None
SNAP00000034943 1/11 Cross Hyb Matching Probes None
SNAP00000034948 1/11 Cross Hyb Matching Probes None
GENEFINDER00000034961 1/11 Cross Hyb Matching Probes None
GENEFINDER00000034965 1/11 Cross Hyb Matching Probes None
SNAP00000041369 1/11 Cross Hyb Matching Probes None
SNAP00000041374 1/11 Cross Hyb Matching Probes None
SNAP00000041384 1/11 Cross Hyb Matching Probes None
GENEFINDER00000041386 1/11 Cross Hyb Matching Probes None
GENEFINDER00000041391 1/11 Cross Hyb Matching Probes None
GENEFINDER00000041398 1/11 Cross Hyb Matching Probes None
SNAP00000043868 2/11 Cross Hyb Matching Probes None
SNAP00000043869 1/11 Cross Hyb Matching Probes None
SNAP00000043876 2/11 Cross Hyb Matching Probes None
GENEFINDER00000043883 1/11 Cross Hyb Matching Probes None
GENEFINDER00000043888 2/11 Cross Hyb Matching Probes None
SNAP00000002639 2/11 Cross Hyb Matching Probes None
SNAP00000002641 1/11 Cross Hyb Matching Probes None
GENEFINDER00000002656 1/11 Cross Hyb Matching Probes None
GENEFINDER00000002661 1/11 Cross Hyb Matching Probes None
SNAP00000004243 1/11 Cross Hyb Matching Probes None
SNAP00000004244 1/11 Cross Hyb Matching Probes None
SNAP00000004246 1/11 Cross Hyb Matching Probes None
GENEFINDER00000004263 1/11 Cross Hyb Matching Probes None
GENEFINDER00000004265 1/11 Cross Hyb Matching Probes None
GENEFINDER00000004273 1/11 Cross Hyb Matching Probes None
SNAP00000005864 2/11 Cross Hyb Matching Probes None
GENEFINDER00000005869 2/11 Cross Hyb Matching Probes None
SNAP00000006004 2/11 Cross Hyb Matching Probes None
SNAP00000006006 2/11 Cross Hyb Matching Probes None
SNAP00000006011 2/11 Cross Hyb Matching Probes None
SNAP00000006013 2/11 Cross Hyb Matching Probes None
SNAP00000006015 2/11 Cross Hyb Matching Probes None
GENEFINDER00000006018 2/11 Cross Hyb Matching Probes None
GENEFINDER00000006020 1/11 Cross Hyb Matching Probes None
GENEFINDER00000006021 2/11 Cross Hyb Matching Probes None
GENEFINDER00000006023 2/11 Cross Hyb Matching Probes None
GENEFINDER00000006024 2/11 Cross Hyb Matching Probes None
SNAP00000007231 2/11 Cross Hyb Matching Probes None
GENEFINDER00000007236 2/11 Cross Hyb Matching Probes None
SNAP00000023386 1/11 Cross Hyb Matching Probes None
GENEFINDER00000023395 1/11 Cross Hyb Matching Probes None
SNAP00000029404 2/11 Cross Hyb Matching Probes None
SNAP00000029405 2/11 Cross Hyb Matching Probes None
GENEFINDER00000029413 2/11 Cross Hyb Matching Probes None
GENEFINDER00000029416 2/11 Cross Hyb Matching Probes None
SNAP00000029847 1/11 Cross Hyb Matching Probes None
GENEFINDER00000029849 1/11 Cross Hyb Matching Probes None
SNAP00000034129 2/11 Cross Hyb Matching Probes None
SNAP00000034134 2/11 Cross Hyb Matching Probes None
GENEFINDER00000034137 2/11 Cross Hyb Matching Probes None
GENEFINDER00000034140 2/11 Cross Hyb Matching Probes None
SNAP00000040134 1/11 Cross Hyb Matching Probes None
GENEFINDER00000040145 1/11 Cross Hyb Matching Probes None
SNAP00000041533 1/11 Cross Hyb Matching Probes None
GENEFINDER00000041543 1/11 Cross Hyb Matching Probes None
SNAP00000043472 1/11 Cross Hyb Matching Probes None
SNAP00000043475 1/11 Cross Hyb Matching Probes None
GENEFINDER00000043484 1/11 Cross Hyb Matching Probes None
GENEFINDER00000043489 1/11 Cross Hyb Matching Probes None
GENEFINDER00000044007 1/11 Cross Hyb Matching Probes None
F26G1.7 2/11 Cross Hyb Matching Probes A 
F26G1.8 4/11 Cross Hyb Matching Probes None
C33F10.9 2/11 Cross Hyb Matching Probes A 
R05F9.8 2/11 Cross Hyb Matching Probes A 
R05F9.3 1/11 Cross Hyb Matching Probes R A 
R05F9.13 2/11 Cross Hyb Matching Probes A 
ZK546.6 1/11 Cross Hyb Matching Probes A 
ZK546.3 1/11 Cross Hyb Matching Probes A 
F59A6.8 3/11 Cross Hyb Matching Probes None
F58A6.8 2/11 Cross Hyb Matching Probes A 
F58A6.9 2/11 Cross Hyb Matching Probes A 
C34F11.6 3/11 Cross Hyb Matching Probes A 
C34F11.4 1/11 Cross Hyb Matching Probes A 
K05F1.7 1/11 Cross Hyb Matching Probes A 
K05F1.2 1/11 Cross Hyb Matching Probes A 
ZK1248.6 1/11 Cross Hyb Matching Probes A 
ZK1248.4 1/11 Cross Hyb Matching Probes A 
ZK1248.17 1/11 Cross Hyb Matching Probes A 
C09B9.6 2/11 Cross Hyb Matching Probes A 
R13H9.2 2/11 Cross Hyb Matching Probes A 
R13H9.4 2/11 Cross Hyb Matching Probes A 
Y59E9AR.7 2/11 Cross Hyb Matching Probes A 
Y59E9AR.1 2/11 Cross Hyb Matching Probes A 
F36H12.7 2/11 Cross Hyb Matching Probes A 
F36H12.6 1/11 Cross Hyb Matching Probes None
ZK354.5 2/11 Cross Hyb Matching Probes A 
ZK354.4 2/11 Cross Hyb Matching Probes A 
ZK354.10 2/11 Cross Hyb Matching Probes None
ZK354.11 2/11 Cross Hyb Matching Probes A 
ZK354.1 2/11 Cross Hyb Matching Probes A 
Y59H11AM.1 1/11 Cross Hyb Matching Probes A 
ZK1251.6 1/11 Cross Hyb Matching Probes A 
T13F2.10 1/11 Cross Hyb Matching Probes A 
T13F2.11 1/11 Cross Hyb Matching Probes A 
K07F5.1 1/11 Cross Hyb Matching Probes A 
K07F5.2 1/11 Cross Hyb Matching Probes A 
K07F5.3 1/11 Cross Hyb Matching Probes A 
F32B6.6 1/11 Cross Hyb Matching Probes A 
C04G2.4 1/11 Cross Hyb Matching Probes A 
K08F4.8 2/11 Cross Hyb Matching Probes A 
Genomic Alignment of Consensus/Exemplar Sequence
Assembly Wormbase March 2004
Alignment(s)
Position Identity Coverage Cytoband
chrII:4898938-4899172(+) 93.59 93.59
chrII:4933159-4933393(+) 92.74 92.74
chrII:4787260-4787494(+) 92.74 92.74
chrIV:5249581-5249815(+) 93.59 93.59
chrIV:5316667-5316901(+) 93.59 93.59
chrIV:9894758-9894992(+) 93.59 93.59
chrIV:9770175-9770409(+) 93.16 93.16
chrIV:9837778-9838012(+) 93.16 93.16
chrIV:5298106-5298448(+) 93.59 93.59
chrIV:9841668-9841902(+) 92.74 92.74
chrIV:5260733-5261075(+) 93.16 93.16
chrII:5115081-5115315(-) 100.0 100.0
chrII:4892294-4892528(-) 92.74 92.74
chrII:4916162-4916396(-) 92.74 92.74
chrIV:5241396-5241630(-) 93.59 93.59
chrIV:9766750-9766984(-) 93.59 93.59
chrIV:5064673-5064907(-) 93.16 93.16
chrIV:5312722-5312956(-) 93.16 93.16
chrIV:5055626-5055860(-) 92.74 92.74
chrIV:5294951-5295185(-) 92.74 92.74
Public Domain and Genome References
Gene Title
Gene Symbol msp-74
Ensembl F09C12.7
Entrez Gene 173882 Entrez gene
SwissProt Q95PJ7 EMBL-EBI
WormBase CE02603 Wormbase
Functional Annotations
Protein Similarities
Method ID Description E-Value
blast AAF60826 Hypothetical protein Y59E9AR.7 [Caenorhabditis elegans] gb|AAF60828.1| Hypothetical protein Y59E9AR.1 [Caenorhabditis elegans] ref|NP_500755.1| Y59E9AR.1 [Caenorhabditis elegans] ref|NP_500752.1| Y59E9AR.7 [Caenorhabditis elegans] 1.0E-40
blast AAA68346 Major sperm protein protein 74 [Caenorhabditis elegans] gb|AAC71085.1| Hypothetical protein ZK1248.4 [Caenorhabditis elegans] gb|AAA96205.1| Hypothetical protein F58A6.9 [Caenorhabditis elegans] ref|NP_495154.1| ZK1248.4 [Caenorhabditis elegans] ref|NP_494960.1| F58A6.9 [Caenorhabditis elegans] ref|NP_494949.1| Major Sperm Protein family member (msp-74) [Caenorhabditis elegans] 1.0E-40
blast AAA68714 Major sperm protein protein 63 [Caenorhabditis elegans] ref|NP_495143.1| Major Sperm Protein family member (msp-63) [Caenorhabditis elegans] sp|Q21244|MSP63_CAEEL Major sperm protein 63 (MSP) 1.0E-40
blast AAF60826 Hypothetical protein Y59E9AR.7 [Caenorhabditis elegans] gb|AAF60828.1| Hypothetical protein Y59E9AR.1 [Caenorhabditis elegans] ref|NP_500755.1| Y59E9AR.1 [Caenorhabditis elegans] ref|NP_500752.1| Y59E9AR.7 [Caenorhabditis elegans] 8.0E-32
Protein Domains
Database ID Description E-Value
Pfam IPR000535 EMBL-EBI Major sperm protein (MSP) domain 7.2E-15
Pfam IPR000535 EMBL-EBI Major sperm protein (MSP) domain 3.7E-14
Sequence
Target Sequence 
>C. ELEGANS:172687_X_AT
gagacttggagttgatccaccatgtggagtcctcgacccaaaggaagctgttcttctggc
cgtttcctgcgatgccttcgccttcggacaagaagacacaaacaacgaccgtattactgt
tgagtggaccaacacccctgatggcgctgccaagcagttccgtcgggaatggttccaagg
agacggtatggttcg

BLASTn GenBank NR
Probe Info <
Probe Sequence(5'-3') Probe X Probe Y Probe Interrogation
Position 		Strandedness
GAGACTTGGAGTTGATCCACCATGT 578 393 18 Antisense
TGATCCACCATGTGGAGTCCTCGAC