[Home] | [Total List]

[172671_x_at] histone-H4

Description K03A1.6 /REP_DB=WormBase Gene ID /WP=CE03252 /GEN=his-38 /SUBMIT=ST.LOUIS /CHR=X /FEA=Sanger Annotation /DEF=his-10, histone-H4
Cluster 6grp_highest_10_10 > 99      6grp_high1_10_10 > 99      4grp_highest_8_8 > 11      4grp_high_8_8 > 47      6grp_highest_nonorm > 95      6grp_total > 95      4grp_total > 40      6grp_cgc > 78      6grp_cgc_sub > In      6grp_total_sub > Increase      6grp_rule_based > S5      4grp_rule_based > L3      

Scale
G range Absolute graph Relative graph Expression Table Dauer Comp.
4 698
1 2 3 4 range
A 226.2
(-3)
P 		651.9
(0.7)
P 		924.6
(3)
P 		675.9
(0.9)
P 		698
B 238.8
(-3)
P 		561.5
(0.1)
P 		871.9
(3)
P 		390.2
(-1.6)
P 		633
C 233.5
(-3)
P 		766
(3)
P 		677.4
(2)
P 		557.5
(0.7)
P 		533
avr 232.8
(-3) 		659.8
(1.3) 		824.6
(3) 		541.2
(0.1) 		592

1 : 1 state (S1, L1)
2 : dauer (ST, LT)
6 1021
1 2 3 4 5 6 range
A 221.2
(-3)
P 		414.8
(-1.7)
P 		347.4
(-2.1)
P 		885.6
(1.5)
P 		1111
(3)
P 		935
(1.8)
P 		890
B 343.7
(-2.3)
P 		233.7
(-3)
P 		473.7
(-1.6)
P 		670.9
(-0.4)
P 		1242.3
(3)
P 		774
(0.2)
P 		1009
C 273.1
(-3)
P 		348.7
(-2.5)
P 		381.2
(-2.3)
P 		859.9
(0.7)
P 		1225.6
(3)
P 		1006.3
(1.6)
P 		953
avr 279.3
(-3) 		332.4
(-2.7) 		400.8
(-2.2) 		805.5
(0.5) 		1193
(3) 		905.1
(1.1) 		914
No Scale
G range Absolute graph Relative graph Expression Table Dauer Comp.
4 166
1 2 3 4 range
A 82.3
(-3)
P 		141.5
(-0.8)
P 		241.7
(3)
P 		98.9
(-2.4)
P 		159
B 76.2
(-3)
P 		138.7
(-0)
P 		202
(3)
P 		83.2
(-2.7)
P 		126
C 77.3
(-3)
P 		220.2
(2.4)
P 		236.1
(3)
P 		94
(-2.4)
P 		159
avr 78.6
(-3) 		166.8
(0.6) 		226.6
(3) 		92
(-2.5) 		148

1 : 1 state (S1, L1)
2 : dauer (ST, LT)
6 464
1 2 3 4 5 6 range
A 40.8
(-3)
P 		147.5
(-0.8)
P 		75.7
(-2.3)
P 		224.6
(0.7)
P 		335.2
(3)
P 		227.7
(0.8)
P 		294
B 119.6
(-2.4)
P 		77.8
(-3)
P 		115
(-2.5)
P 		177.7
(-1.6)
P 		504.7
(3)
P 		288.6
(-0)
P 		427
C 101.2
(-2.9)
P 		106.4
(-2.8)
P 		97
(-3)
P 		172.9
(-1.5)
P 		396.6
(3)
P 		336.9
(1.8)
P 		300
avr 87.2
(-3) 		110.6
(-2.6) 		95.9
(-2.8) 		191.7
(-1.1) 		412.2
(3) 		284.4
(0.6) 		325
NetAffx Links Cluster Members
Consensus/Exemplar
Group Members
GeneChip Array Information
Probe Set ID 172671_x_at
GeneChip Array C. elegans Genome Array
Organism Common Name Nematode
Probe Design Information
Transcript ID(Array Design) affy.Ce.17210
Sequence Type Exemplar sequence
Representative Public ID K03A1.6 NCBI
Target Description K03A1.6 /REP_DB=WormBase Gene ID /WP=CE03252 /GEN=his-38 /SUBMIT=ST.LOUIS /CHR=X /FEA=Sanger Annotation /DEF=his-10, histone-H4
Cluster Evidence This cluster is supported by a Sanger Annotation.
Annotation Method Description
Annotation Description This probe set was annotated using the Matching Probes based pipeline to a RefSeq identifier using 1 transcript(s).
Annotation Grade This is a grade A annotation.
Annotation Transcript Cluster (# of Matching Probes) NM_076830(11)
Transcript Assignments
Representative
Transcript		 Description Matching Probes Related Probesets by Grade
NM_076830 NCBI Caenorhabditis elegans K03A1.6 (histone-H4) mRNA, complete cds. 11/11 None
SNAP00000013867 ENSEMBL cdna:SNAP chromosome:CEL140:X:7309510:7309821:-1 11/11 None
GENEFINDER00000013872 ENSEMBL cdna:GeneFinder chromosome:CEL140:X:7309510:7309821:-1 11/11 None
K03A1.6 ENSEMBL cdna:known chromosome:CEL140:X:7309510:7309821:-1 gene:K03A1.6 11/11 None
Annotation Notes
Cross Hybridizing mRNA Matched Probes Nature of Assignment Related Probesets by Grade
NM_072799 4/11 Cross Hyb Matching Probes A 
NM_072874 4/11 Cross Hyb Matching Probes A 
NM_072890 4/11 Cross Hyb Matching Probes A 
NM_072897 4/11 Cross Hyb Matching Probes A 
NM_074633 2/11 Cross Hyb Matching Probes A 
NM_069732 1/11 Cross Hyb Matching Probes A 
NM_069738 1/11 Cross Hyb Matching Probes A 
NM_069753 1/11 Cross Hyb Matching Probes A 
SNAP00000002622 1/11 Cross Hyb Matching Probes None
GENEFINDER00000002634 1/11 Cross Hyb Matching Probes None
SNAP00000028587 1/11 Cross Hyb Matching Probes None
GENEFINDER00000028597 1/11 Cross Hyb Matching Probes None
SNAP00000035839 1/11 Cross Hyb Matching Probes None
GENEFINDER00000035848 1/11 Cross Hyb Matching Probes None
SNAP00000015091 4/11 Cross Hyb Matching Probes None
GENEFINDER00000015147 4/11 Cross Hyb Matching Probes None
SNAP00000018182 4/11 Cross Hyb Matching Probes None
SNAP00000018189 4/11 Cross Hyb Matching Probes None
GENEFINDER00000018193 4/11 Cross Hyb Matching Probes None
GENEFINDER00000018202 4/11 Cross Hyb Matching Probes None
SNAP00000027917 2/11 Cross Hyb Matching Probes None
GENEFINDER00000027926 2/11 Cross Hyb Matching Probes None
SNAP00000030774 4/11 Cross Hyb Matching Probes None
GENEFINDER00000030786 4/11 Cross Hyb Matching Probes None
B0035.9 1/11 Cross Hyb Matching Probes A 
F54E12.3 1/11 Cross Hyb Matching Probes A 
F22B3.1 1/11 Cross Hyb Matching Probes A 
F45F2.3 4/11 Cross Hyb Matching Probes A 
F07B7.9 4/11 Cross Hyb Matching Probes A 
K06C4.2 4/11 Cross Hyb Matching Probes A 
K06C4.10 4/11 Cross Hyb Matching Probes A 
T10C6.14 2/11 Cross Hyb Matching Probes A 
Genomic Alignment of Consensus/Exemplar Sequence
Assembly Wormbase March 2004
Alignment(s)
Position Identity Coverage Cytoband
chrV:8537802-8538114(+) 96.79 96.79
chrV:8900815-8901127(+) 96.47 96.47
chrV:16044864-16045414(+) 95.83 95.83
chrV:8892075-8892387(-) 96.79 96.79
chrV:8849980-8850292(-) 96.79 96.79
chrX:7309508-7309820(-) 100.0 100.0
Public Domain and Genome References
Gene Title histone-H4
Gene Symbol his-38
Ensembl K03A1.6
Entrez Gene 191680 Entrez gene
SwissProt P62784 EMBL-EBI
WormBase CE03252 Wormbase
Functional Annotations
Ortholog
ID Title Organism
ATH1-121501:247692_S_AT histone H4 at
ATH1-121501:252562_S_AT histone H4 at
CANINE_2:CFAAFFX.251.1.S1_S_AT similar to germinal histone H4 gene cfa
HG-U133A:214634_AT histone 1, H4i hs
HG-U133A_2:214634_AT histone 1, H4i hs
HG-FOCUS:214634_AT histone 1, H4i hs
HG-U133_PLUS_2:214634_AT histone 1, H4i hs
HG-U95AV2:762_F_AT histone 1, H4i hs
HC-G110:762_F_AT histone 1, H4i hs
HUGENEFL:AB000905_AT histone 1, H4i hs
U133_X3P:HS.248172.0.S2_3P_AT histone 1, H4i hs
MOUSE430_2:1431333_AT histone 1, H4h mm
MOE430B:1431333_AT histone 1, H4h mm
MOUSE430_2:1428014_AT histone 1, H4h mm
MOE430A:1428014_AT histone 1, H4h mm
MOUSE430A_2:1428014_AT histone 1, H4h mm
MU11KSUBB:MSA.753.0_AT histone 1, H4h mm
MG-U74BV2:165373_AT histone 1, H4h mm
MOE430A:1422948_S_AT histone 1, H4h mm
MOUSE430A_2:1422948_S_AT histone 1, H4h mm
MOUSE430_2:1422948_S_AT histone 1, H4h mm
MU19KSUBA:TC14415_AT Histone 1, H4h (Hist1h4h), mRNA mm
RG-U34C:AA848573_AT germinal histone H4 gene rn
RG-U34C:RC_AI176792_AT germinal histone H4 gene rn
RAE230A:1372726_AT germinal histone H4 gene rn
RAT230_2:1372726_AT germinal histone H4 gene rn
RAE230A:1374600_AT germinal histone H4 gene rn
RAT230_2:1374600_AT germinal histone H4 gene rn
Gene Ontology
GO Biological Process (view graph)
ID Description Evidence Links
6334 nucleosome assembly inferred from electronic annotation QuickGO AmiGO
7001 chromosome organization and biogenesis (sensu Eukaryota) inferred from electronic annotation QuickGO AmiGO
GO Cellular Component (view graph)
ID Description Evidence Links
786 nucleosome inferred from electronic annotation QuickGO AmiGO
5634 nucleus inferred from electronic annotation QuickGO AmiGO
GO Molecular Function (view graph)
ID Description Evidence Links
3677 DNA binding inferred from electronic annotation QuickGO AmiGO
Protein Similarities
Method ID Description E-Value
blast CAB05839 Hypothetical protein ZK131.8 [Caenorhabditis elegans] emb|CAB05837.1| Hypothetical protein ZK131.4 [Caenorhabditis elegans] emb|CAB05835.4| Hypothetical protein ZK131.1 [Caenorhabditis elegans] emb|CAB03396.1| Hypothetical protein T23D8.5 [Caenorhabditis elegans] emb|CAA94742.1| Hypothetical protein C50F4.7 [Caenorhabditis elegans] emb|CAA97407.1| Hypothetical protein B0035.9 [Caenorhabditis elegans] emb|CAA92734.1| Hypothetical protein F22B3.1 [Caenorhabditis elegans] emb|CAB07657.1| Hypothetical protein T10C6.14 [Caenorhabditis elegans] emb|CAB05210.1| Hypothetical protein F54E12.3 [Caenorhabditis elegans] gb|AAC05101.1| Histone protein 31 [Caenorhabditis elegans] gb|AAK84518.1| Histone protein 50 [Caenorhabditis elegans] gb|AAF98220.1| Histone protein 28 [Caenorhabditis elegans] gb|AAF98223.1| Histone protein 18 [Caenorhabditis elegans] gb|AAA83329.1| Histone protein 38 [Caenorhabditis elegans] emb|CAA24645.1| unnamed protein product [Strongylocentrotus purpuratus] emb|CAA38053.1| histone H4 [Pycnopodia helianthoides] emb|CAA38051.1| histone H4 [Pisaster ochraceus] emb|CAA38049.1| H4 histone [Pisaster brevispinus] emb|CAA33643.1| Histone protein [Caenorhabditis elegans] emb|CAA27581.1| unnamed protein product [Strongylocentrotus purpuratus] emb|CAA25241.1| unnamed protein product [Lytechinus pictus] gb|AAC48026.1| Histone protein 5 [Caenorhabditis elegans] ref|NP_509231.1| K03A1.6 [Caenorhabditis elegans] ref|NP_501406.1| HIStone family member (his-31) [Caenorhabditis elegans] ref|NP_496893.1| HIStone family member (his-10) [Caenorhabditis elegans] ref|NP_507034.1| HIStone family member (his-1) [Caenorhabditis elegans] ref|NP_492641.1| HIStone family member (his-67) [Caenorhabditis elegans] ref|NP_505466.1| HIStone family member (his-37) [Caenorhabditis elegans] ref|NP_505298.1| HIStone family member (his-18) [Caenorhabditis elegans] ref|NP_505291.1| HIStone family member (his-28) [Caenorhabditis elegans] ref|NP_505275.1| HIStone family member (his-50) [Caenorhabditis elegans] ref|NP_505200.1| HIStone family member (his-5) [Caenorhabditis elegans] ref|NP_502154.1| HIStone family member (his-64) [Caenorhabditis elegans] ref|NP_502139.1| HIStone family member (his-56) [Caenorhabditis elegans] ref|NP_502133.1| HIStone family member (his-46) [Caenorhabditis elegans] ref|NP_496896.1| HIStone family member (his-26) [Caenorhabditis elegans] ref|NP_496889.1| HIStone family member (his-14) [Caenorhabditis elegans] ref|XP_780884.1| PREDICTED: similar to histone (his-67) [Strongylocentrotus purpuratus] ref|XP_781796.1| PREDICTED: similar to histone (his-67) [Strongylocentrotus purpuratus] ref|NP_999707.1| H4 histone protein [Strongylocentrotus purpuratus] ref|NP_999716.1| late histone gene L1 H4 [Strongylocentrotus purpuratus] ref|NP_999715.1| late histone gene L2 H4 [Strongylocentrotus purpuratus] ref|NP_999713.1| late embryonic histone H4 [Strongylocentrotus purpuratus] sp|P62779|H4_PYCHE Histone H4 sp|P62778|H4_PISOC Histone H4 sp|P62777|H4_PISBR Histone H4 sp|P62780|H4_PARLI Histone H4 sp|P62782|H4_LYTPI Histone H4 sp|P62776|H4_HOLTU Histone H4 sp|P62784|H4_CAEEL Histone H4 emb|CAE60210.1| Hypothetical protein CBG03774 [Caenorhabditis briggsae] emb|CAE72198.1| Hypothetical protein CBG19306 [Caenorhabditis briggsae] emb|CAE62043.1| Hypothetical protein CBG06059 [Caenorhabditis briggsae] emb|CAE62040.1| Hypothetical protein CBG06056 [Caenorhabditis briggsae] emb|CAE61894.1| Hypothetical protein CBG05885 [Caenorhabditis briggsae] emb|CAE61864.1| Hypothetical protein CBG05842 [Caenorhabditis briggsae] emb|CAE61861.1| Hypothetical protein CBG05839 [Caenorhabditis briggsae] emb|CAE75444.1| Hypothetical protein CBG23438 [Caenorhabditis briggsae] emb|CAE58375.1| Hypothetical protein CBG01504 [Caenorhabditis briggsae] emb|CAE58373.1| Hypothetical protein CBG01500 [Caenorhabditis briggsae] gb|AAB48834.1| cleavage stage histone H4 [Psammechinus miliaris] pir||S01618 histone H4, embryonic (clones L1 and L2) - sea urchin (Strongylocentrotus purpuratus) emb|CAA86298.1| histone H4 [Holothuria tubulosa] emb|CAA29849.1| unnamed protein product [Strongylocentrotus purpuratus] emb|CAA29847.1| unnamed protein product [Strongylocentrotus purpuratus] emb|CAA76307.1| histone H4 [Paracentrotus lividus] emb|CAA25630.1| histone H4 (aa 1-103) [Psammechinus miliaris] sp|P62783|H4_STRPU Histone H4 sp|P62781|H4_PSAMI Histone H4 gb|AAA69664.1| histone gb|AAA30024.1| histone H4 gb|AAA30002.1| histone H4 prf||2209257B histone H4 7.0E-40
blast AAB00649 Histone protein 60 [Caenorhabditis elegans] ref|NP_501203.1| F55G1.11 [Caenorhabditis elegans] pir||T29230 hypothetical protein F55G1.11 - Caenorhabditis elegans 7.0E-40
blast HSUR4P histone H4, embryonic - sea urchin (Strongylocentrotus purpuratus) pir||HSUR4 histone H4 - sea urchin (Psammechinus miliaris) pir||S68537 histone H4 - starfish (Asterina pectinifera) gb|AAA30054.1| H4 histone protein 7.0E-40
Protein Domains
Database ID Description E-Value
Pfam IPR007125 EMBL-EBI Histone core 5.3E-13
Sequence
Target Sequence 
>C. ELEGANS:172671_X_AT
ggaaaaggtggtgccaagcgccatcgcaaggtccttcgagacaacatccaaggaatcacc
aagccagctattcgccgtcttgctcgtcgtggtggagtcaagcgtatttctggactcatc
tatgaggaaactcgtggagttctcaaggtgttcctcgagaacgtcatccgtgatgccgta
acttactgtgagcacgccaagagaaagaccgttaccgccatggacgtcgtctacgctttg
aag

BLASTn GenBank NR
Probe Info
Probe Sequence(5'-3') Probe X Probe Y Probe Interrogation
Position 		Strandedness
GGAAAAGGTGGTGCCAAGCGCCATC 695 527 46 Antisense
GCCATCGCAAGGTCCTTCGAGACAA 179 279 65 Antisense
AGGAATCACCAAGCCAGCTATTCGC 11 55 96 Antisense
GCTCGTCGTGGTGGAGTCAAGCGTA 495 295 127 Antisense
CAAGCGTATTTCTGGACTCATCTAT 610 185 144 Antisense
CGTGGAGTTCTCAAGGTGTTCCTCG 366 245 178 Antisense
TGTTCCTCGAGAACGTCATCCGTGA 678 561 194 Antisense
TCATCCGTGATGCCGTAACTTACTG 83 623 209 Antisense
GTAACTTACTGTGAGCACGCCAAGA 540 461 223 Antisense
AAGAGAAAGACCGTTACCGCCATGG 462 151 244 Antisense
CATGGACGTCGTCTACGCTTTGAAG 10 209 264 Antisense
Sequence Source Affymetrix Proprietary Database