[Home] | [Total List]

[172661_x_at]

Description F17E9.12 /REP_DB=WormBase Gene ID /WP=CE03252 /GEN=his-31 /GB=AAC05101.1 /SUBMIT=ST.LOUIS /CHR=4 /FEA=Sanger Annotation
Cluster 6grp_highest_10_10 > 78      6grp_high1_10_10 > 97      4grp_highest_8_8 > 12      4grp_high_8_8 > 38      6grp_highest_nonorm > 92      6grp_total > 87      4grp_total > 32      6grp_highest_sub > In      6grp_cgc > 58      6grp_high1_sub > In      6grp_cgc_sub > In      6grp_total_sub > Increase      6grp_rule_based > S6      4grp_rule_based > L3      

Scale
G range Absolute graph Relative graph Expression Table Dauer Comp.
4 342
1 2 3 4 range
A 181.5
(-3)
P 		494.1
(2.6)
P 		518.1
(3)
P 		484.3
(2.4)
P 		337
B 199.7
(-3)
P 		390.6
(0.6)
P 		521.2
(3)
P 		501.1
(2.6)
P 		322
C 225.6
(-3)
P 		523.4
(3)
P 		433.9
(1.2)
P 		470.4
(1.9)
P 		298
avr 202.3
(-3) 		469.4
(2.5) 		491.1
(3) 		485.3
(2.9) 		289

1 : 1 state (S1, L1)
2 : dauer (ST, LT)
6 357
1 2 3 4 5 6 range
A 171.7
(-3)
P 		186.7
(-2.5)
P 		232.8
(-1.1)
P 		262.3
(-0.1)
P 		323.9
(1.8)
P 		361.8
(3)
P 		190
B 198.4
(-3)
P 		214.9
(-2.5)
P 		244.2
(-1.5)
P 		244.4
(-1.5)
P 		295.6
(0.2)
P 		383.1
(3)
P 		185
C 175.7
(-2.8)
P 		246
(-1.7)
P 		166.3
(-3)
P 		209.3
(-2.3)
P 		321.9
(-0.4)
P 		522.9
(3)
P 		357
avr 181.9
(-3) 		215.9
(-2.2) 		214.4
(-2.2) 		238.7
(-1.6) 		313.8
(0.3) 		422.6
(3) 		241
No Scale
G range Absolute graph Relative graph Expression Table Dauer Comp.
4 88
1 2 3 4 range
A 66.1
(-3)
P 		107.3
(0.6)
P 		135.4
(3)
P 		70.9
(-2.6)
P 		69
B 63.7
(-3)
P 		96.5
(0.4)
P 		120.8
(3)
P 		106.8
(1.5)
P 		57
C 74.7
(-3)
P 		150.5
(2.9)
P 		151.2
(3)
P 		79.3
(-2.6)
P 		77
avr 68.2
(-3) 		118.1
(1.4) 		135.8
(3) 		85.7
(-1.4) 		68

1 : 1 state (S1, L1)
2 : dauer (ST, LT)
6 143
1 2 3 4 5 6 range
A 31.7
(-3)
P 		66.4
(0.1)
P 		50.7
(-1.3)
P 		66.5
(0.2)
P 		97.8
(3)
P 		88.1
(2.1)
P 		66
B 69
(-2.3)
P 		71.5
(-2.1)
P 		59.3
(-3)
P 		64.7
(-2.6)
P 		120.1
(1.4)
P 		142.9
(3)
P 		84
C 65.1
(-2)
P 		75.1
(-1.5)
P 		42.3
(-3)
P 		42.1
(-3)
P 		104.2
(-0.2)
P 		175.1
(3)
P 		133
avr 55.3
(-2.7) 		71
(-1.6) 		50.8
(-3) 		57.8
(-2.5) 		107.4
(1) 		135.4
(3) 		85
NetAffx Links Cluster Members
Consensus/Exemplar
Group Members
GeneChip Array Information
Probe Set ID 172661_x_at
GeneChip Array C. elegans Genome Array
Organism Common Name Nematode
Probe Design Information
Transcript ID(Array Design) affy.Ce.9387
Sequence Type Exemplar sequence
Representative Public ID F17E9.12 NCBI
Target Description F17E9.12 /REP_DB=WormBase Gene ID /WP=CE03252 /GEN=his-31 /GB=AAC05101.1 /SUBMIT=ST.LOUIS /CHR=4 /FEA=Sanger Annotation
Annotation Method Description
Annotation Description This probe set was annotated using the Matching Probes based pipeline to a RefSeq identifier using 1 transcript(s).
Annotation Grade This is a grade A annotation.
Annotation Transcript Cluster (# of Matching Probes) NM_069005(11)
Transcript Assignments
Representative
Transcript		 Description Matching Probes Related Probesets by Grade
NM_069005 NCBI Caenorhabditis elegans HIStone family member (his-31) (his-31) mRNA, complete cds. 11/11 None
SNAP00000000479 ENSEMBL cdna:SNAP chromosome:CEL140:IV:8333654:8333965:-1 11/11 None
GENEFINDER00000000499 ENSEMBL cdna:GeneFinder chromosome:CEL140:IV:8333654:8333965:-1 11/11 None
F17E9.12 ENSEMBL cdna:known chromosome:CEL140:IV:8333654:8333965:-1 gene:F17E9.12 11/11 None
Annotation Notes
Cross Hybridizing mRNA Matched Probes Nature of Assignment Related Probesets by Grade
NM_072874 1/11 Cross Hyb Matching Probes A 
NM_072890 1/11 Cross Hyb Matching Probes A 
NM_069732 4/11 Cross Hyb Matching Probes A 
NM_069738 4/11 Cross Hyb Matching Probes A 
NM_069753 4/11 Cross Hyb Matching Probes A 
SNAP00000002622 4/11 Cross Hyb Matching Probes None
GENEFINDER00000002634 4/11 Cross Hyb Matching Probes None
SNAP00000028587 4/11 Cross Hyb Matching Probes None
GENEFINDER00000028597 4/11 Cross Hyb Matching Probes None
SNAP00000035839 4/11 Cross Hyb Matching Probes None
GENEFINDER00000035848 4/11 Cross Hyb Matching Probes None
SNAP00000015091 1/11 Cross Hyb Matching Probes None
GENEFINDER00000015147 1/11 Cross Hyb Matching Probes None
SNAP00000018182 1/11 Cross Hyb Matching Probes None
GENEFINDER00000018193 1/11 Cross Hyb Matching Probes None
SNAP00000030774 1/11 Cross Hyb Matching Probes None
GENEFINDER00000030786 1/11 Cross Hyb Matching Probes None
B0035.9 4/11 Cross Hyb Matching Probes A 
F54E12.3 4/11 Cross Hyb Matching Probes A 
F22B3.1 4/11 Cross Hyb Matching Probes A 
F45F2.3 1/11 Cross Hyb Matching Probes A 
F07B7.9 1/11 Cross Hyb Matching Probes A 
K06C4.2 1/11 Cross Hyb Matching Probes A 
Genomic Alignment of Consensus/Exemplar Sequence
Assembly Wormbase March 2004
Alignment(s)
Position Identity Coverage Cytoband
chrII:13825425-13825737(+) 91.67 91.67
chrIV:11338498-11338810(+) 94.87 94.87
chrIV:11407092-11407404(+) 94.55 94.55
chrV:8900815-8901127(+) 90.06 90.06
chrV:8537802-8538114(+) 90.06 90.06
chrII:13822957-13823269(-) 91.67 91.67
chrII:13819519-13819831(-) 91.67 91.67
chrIV:8333659-8333971(-) 100.0 100.0
chrIV:11325994-11326306(-) 94.87 94.87
chrIV:7487670-7487982(-) 93.59 93.59
Public Domain and Genome References
Gene Title
Gene Symbol his-31
Ensembl F17E9.12
Entrez Gene 191677 Entrez gene
SwissProt P62784 EMBL-EBI
WormBase CE03252 Wormbase
Functional Annotations
Ortholog
ID Title Organism
ATH1-121501:247692_S_AT histone H4 at
CANINE_2:CFAAFFX.17923.1.S1_AT similar to germinal histone H4 gene cfa
HU35KSUBA:T88846_F_AT histone 1, H4k hs
HG-U133_PLUS_2:208580_X_AT histone 1, H4k hs
HG-U133A:208580_X_AT histone 1, H4k hs
HG-FOCUS:208580_X_AT histone 1, H4k hs
HG-U133A_2:208580_X_AT histone 1, H4k hs
HUGENEFL:X60483_AT histone 1, H4k hs
HUGENEFL:X60484_AT histone 1, H4k hs
U133_X3P:G11415029_3P_X_AT histone 1, H4k hs
HG-U133A_2:214463_X_AT histone 1, H4k hs
HG-FOCUS:214463_X_AT histone 1, H4k hs
HG-U133_PLUS_2:214463_X_AT histone 1, H4k hs
HG-U133A:214463_X_AT histone 1, H4k hs
HG-U95AV2:31521_F_AT histone 1, H4k hs
HG-U95AV2:34027_F_AT histone 1, H4k hs
HU35KSUBA:T88846_F_AT histone 1, H4j hs
HG-U133_PLUS_2:208580_X_AT histone 1, H4j hs
HG-U133A:208580_X_AT histone 1, H4j hs
HG-FOCUS:208580_X_AT histone 1, H4j hs
HG-U133A_2:208580_X_AT histone 1, H4j hs
HUGENEFL:X60483_AT histone 1, H4j hs
HUGENEFL:X60484_AT histone 1, H4j hs
U133_X3P:G11415029_3P_X_AT histone 1, H4j hs
HG-U133A_2:214463_X_AT histone 1, H4j hs
HG-FOCUS:214463_X_AT histone 1, H4j hs
HG-U133_PLUS_2:214463_X_AT histone 1, H4j hs
HG-U133A:214463_X_AT histone 1, H4j hs
HG-U95AV2:31521_F_AT histone 1, H4j hs
HG-U95AV2:34027_F_AT histone 1, H4j hs
MOE430A:1422948_S_AT histone 1, H4j mm
MOUSE430A_2:1422948_S_AT histone 1, H4j mm
MOUSE430_2:1422948_S_AT histone 1, H4j mm
MOE430B:1431658_AT histone 1, H4j mm
MOUSE430_2:1431658_AT histone 1, H4j mm
MOE430A:1422948_S_AT histone 1, H4k mm
MOUSE430A_2:1422948_S_AT histone 1, H4k mm
MOUSE430_2:1422948_S_AT histone 1, H4k mm
Gene Ontology
GO Biological Process (view graph)
ID Description Evidence Links
6334 nucleosome assembly inferred from electronic annotation QuickGO AmiGO
7001 chromosome organization and biogenesis (sensu Eukaryota) inferred from electronic annotation QuickGO AmiGO
GO Cellular Component (view graph)
ID Description Evidence Links
786 nucleosome inferred from electronic annotation QuickGO AmiGO
5634 nucleus inferred from electronic annotation QuickGO AmiGO
GO Molecular Function (view graph)
ID Description Evidence Links
3677 DNA binding inferred from electronic annotation QuickGO AmiGO
Protein Similarities
Method ID Description E-Value
blast CAB05839 Hypothetical protein ZK131.8 [Caenorhabditis elegans] emb|CAB05837.1| Hypothetical protein ZK131.4 [Caenorhabditis elegans] emb|CAB05835.4| Hypothetical protein ZK131.1 [Caenorhabditis elegans] emb|CAB03396.1| Hypothetical protein T23D8.5 [Caenorhabditis elegans] emb|CAA94742.1| Hypothetical protein C50F4.7 [Caenorhabditis elegans] emb|CAA97407.1| Hypothetical protein B0035.9 [Caenorhabditis elegans] emb|CAA92734.1| Hypothetical protein F22B3.1 [Caenorhabditis elegans] emb|CAB07657.1| Hypothetical protein T10C6.14 [Caenorhabditis elegans] emb|CAB05210.1| Hypothetical protein F54E12.3 [Caenorhabditis elegans] gb|AAC05101.1| Histone protein 31 [Caenorhabditis elegans] gb|AAK84518.1| Histone protein 50 [Caenorhabditis elegans] gb|AAF98220.1| Histone protein 28 [Caenorhabditis elegans] gb|AAF98223.1| Histone protein 18 [Caenorhabditis elegans] gb|AAA83329.1| Histone protein 38 [Caenorhabditis elegans] emb|CAA24645.1| unnamed protein product [Strongylocentrotus purpuratus] emb|CAA38053.1| histone H4 [Pycnopodia helianthoides] emb|CAA38051.1| histone H4 [Pisaster ochraceus] emb|CAA38049.1| H4 histone [Pisaster brevispinus] emb|CAA33643.1| Histone protein [Caenorhabditis elegans] emb|CAA27581.1| unnamed protein product [Strongylocentrotus purpuratus] emb|CAA25241.1| unnamed protein product [Lytechinus pictus] gb|AAC48026.1| Histone protein 5 [Caenorhabditis elegans] ref|NP_509231.1| K03A1.6 [Caenorhabditis elegans] ref|NP_501406.1| HIStone family member (his-31) [Caenorhabditis elegans] ref|NP_496893.1| HIStone family member (his-10) [Caenorhabditis elegans] ref|NP_507034.1| HIStone family member (his-1) [Caenorhabditis elegans] ref|NP_492641.1| HIStone family member (his-67) [Caenorhabditis elegans] ref|NP_505466.1| HIStone family member (his-37) [Caenorhabditis elegans] ref|NP_505298.1| HIStone family member (his-18) [Caenorhabditis elegans] ref|NP_505291.1| HIStone family member (his-28) [Caenorhabditis elegans] ref|NP_505275.1| HIStone family member (his-50) [Caenorhabditis elegans] ref|NP_505200.1| HIStone family member (his-5) [Caenorhabditis elegans] ref|NP_502154.1| HIStone family member (his-64) [Caenorhabditis elegans] ref|NP_502139.1| HIStone family member (his-56) [Caenorhabditis elegans] ref|NP_502133.1| HIStone family member (his-46) [Caenorhabditis elegans] ref|NP_496896.1| HIStone family member (his-26) [Caenorhabditis elegans] ref|NP_496889.1| HIStone family member (his-14) [Caenorhabditis elegans] ref|XP_780884.1| PREDICTED: similar to histone (his-67) [Strongylocentrotus purpuratus] ref|XP_781796.1| PREDICTED: similar to histone (his-67) [Strongylocentrotus purpuratus] ref|NP_999707.1| H4 histone protein [Strongylocentrotus purpuratus] ref|NP_999716.1| late histone gene L1 H4 [Strongylocentrotus purpuratus] ref|NP_999715.1| late histone gene L2 H4 [Strongylocentrotus purpuratus] ref|NP_999713.1| late embryonic histone H4 [Strongylocentrotus purpuratus] sp|P62779|H4_PYCHE Histone H4 sp|P62778|H4_PISOC Histone H4 sp|P62777|H4_PISBR Histone H4 sp|P62780|H4_PARLI Histone H4 sp|P62782|H4_LYTPI Histone H4 sp|P62776|H4_HOLTU Histone H4 sp|P62784|H4_CAEEL Histone H4 emb|CAE60210.1| Hypothetical protein CBG03774 [Caenorhabditis briggsae] emb|CAE72198.1| Hypothetical protein CBG19306 [Caenorhabditis briggsae] emb|CAE62043.1| Hypothetical protein CBG06059 [Caenorhabditis briggsae] emb|CAE62040.1| Hypothetical protein CBG06056 [Caenorhabditis briggsae] emb|CAE61894.1| Hypothetical protein CBG05885 [Caenorhabditis briggsae] emb|CAE61864.1| Hypothetical protein CBG05842 [Caenorhabditis briggsae] emb|CAE61861.1| Hypothetical protein CBG05839 [Caenorhabditis briggsae] emb|CAE75444.1| Hypothetical protein CBG23438 [Caenorhabditis briggsae] emb|CAE58375.1| Hypothetical protein CBG01504 [Caenorhabditis briggsae] emb|CAE58373.1| Hypothetical protein CBG01500 [Caenorhabditis briggsae] gb|AAB48834.1| cleavage stage histone H4 [Psammechinus miliaris] pir||S01618 histone H4, embryonic (clones L1 and L2) - sea urchin (Strongylocentrotus purpuratus) emb|CAA86298.1| histone H4 [Holothuria tubulosa] emb|CAA29849.1| unnamed protein product [Strongylocentrotus purpuratus] emb|CAA29847.1| unnamed protein product [Strongylocentrotus purpuratus] emb|CAA76307.1| histone H4 [Paracentrotus lividus] emb|CAA25630.1| histone H4 (aa 1-103) [Psammechinus miliaris] sp|P62783|H4_STRPU Histone H4 sp|P62781|H4_PSAMI Histone H4 gb|AAA69664.1| histone gb|AAA30024.1| histone H4 gb|AAA30002.1| histone H4 prf||2209257B histone H4 7.0E-40
blast AAB00649 Histone protein 60 [Caenorhabditis elegans] ref|NP_501203.1| F55G1.11 [Caenorhabditis elegans] pir||T29230 hypothetical protein F55G1.11 - Caenorhabditis elegans 7.0E-40
blast HSUR4P histone H4, embryonic - sea urchin (Strongylocentrotus purpuratus) pir||HSUR4 histone H4 - sea urchin (Psammechinus miliaris) pir||S68537 histone H4 - starfish (Asterina pectinifera) gb|AAA30054.1| H4 histone protein 7.0E-40
Protein Domains
Database ID Description E-Value
Pfam IPR007125 EMBL-EBI Histone core 5.3E-13
Sequence
Target Sequence 
>C. ELEGANS:172661_X_AT
aaaaggaggagccaagcgccatcgcaaggtgctccgtgataacattcaaggtatcaccaa
gccagcaattcgccgtctcgccagaagaggaggagtcaagagaatttctggattgatcta
cgaggaaacacgtggagtcttgaaggtgttccttgagaacgtcatccgtgatgctgtcac
ctactgcgagcacgccaagagaaagacggtaactgctatggacgtcgtctatgctctgaa
gcgtca

BLASTn GenBank NR
Probe Info
Probe Sequence(5'-3') Probe X Probe Y Probe Interrogation
Position 		Strandedness
AAAAGGAGGAGCCAAGCGCCATCGC 708 131 48 Antisense
ATCGCAAGGTGCTCCGTGATAACAT 66 37 68 Antisense
GGTGCTCCGTGATAACATTCAAGGT 579 501 75 Antisense
AGGTATCACCAAGCCAGCAATTCGC 703 57 96 Antisense
TCGCCGTCTCGCCAGAAGAGGAGGA 39 599 117 Antisense
ACGTGGAGTCTTGAAGGTGTTCCTT 191 93 177 Antisense
GGTGTTCCTTGAGAACGTCATCCGT 167 501 192 Antisense
GAACGTCATCCGTGATGCTGTCACC 186 347 204 Antisense
ACCTACTGCGAGCACGCCAAGAGAA 251 87 226 Antisense
ACGGTAACTGCTATGGACGTCGTCT 8 97 253 Antisense
ACGTCGTCTATGCTCTGAAGCGTCA 450 95 269 Antisense
Sequence Source Affymetrix Proprietary Database