[Home] | [Total List]

[172649_x_at] Histone

Description F55G1.10 /REP_DB=WormBase Gene ID /WP=CE04501 /GB=AAB00647.1 /SUBMIT=ST.LOUIS /CHR=4 /FEA=Sanger Annotation /DEF=Histone
Cluster 6grp_highest_10_10 > 39      6grp_high1_10_10 > 82      4grp_highest_8_8 > 02      4grp_high_8_8 > 46      6grp_highest_nonorm > 77      6grp_total > 80      4grp_total > 49      6grp_highest_sub > 04      6grp_cgc > 86      6grp_high1_sub > 04      6grp_cgc_sub > 04      6grp_total_sub > Hat      4grp_rule_based > L3      

Scale
G range Absolute graph Relative graph Expression Table Dauer Comp.
4 1593
1 2 3 4 range
A 1167.1
(-2.4)
P 		1831.6
(1.9)
P 		2011
(3)
P 		1068.7
(-3)
P 		942
B 1228.6
(-3)
P 		2114.9
(1.2)
P 		2488.7
(3)
P 		1426.3
(-2.1)
P 		1260
C 895.5
(-3)
P 		2413.3
(3)
P 		2145.4
(1.9)
P 		1335.3
(-1.3)
P 		1518
avr 1097.1
(-3) 		2119.9
(2.5) 		2215
(3) 		1276.8
(-2) 		1118

1 : 1 state (S1, L1)
2 : dauer (ST, LT)
6 1285
1 2 3 4 5 6 range
A 795.4
(-3)
P 		1168.6
(-1.2)
P 		1727.5
(1.6)
P 		2009.1
(3)
P 		1086
(-1.6)
P 		1273.4
(-0.6)
P 		1214
B 1375.3
(0.7)
P 		1791.8
(3)
P 		723.9
(-3)
P 		1506.7
(1.4)
P 		1320.9
(0.4)
P 		1424.5
(0.9)
P 		1068
C 1299.9
(-2.7)
P 		1282.2
(-3)
P 		1350.1
(-1.9)
P 		1346
(-2)
P 		1661.7
(3)
P 		1544.8
(1.2)
P 		380
avr 1156.9
(-3) 		1414.2
(0.3) 		1267.2
(-1.6) 		1620.6
(3) 		1356.2
(-0.4) 		1414.2
(0.3) 		464
No Scale
G range Absolute graph Relative graph Expression Table Dauer Comp.
4 591
1 2 3 4 range
A 424.9
(1.4)
P 		397.6
(0.9)
P 		525.7
(3)
P 		156.4
(-3)
P 		369
B 391.8
(-1.1)
P 		522.3
(1.8)
P 		576.7
(3)
P 		303.9
(-3)
P 		273
C 296.4
(-2.2)
P 		693.8
(2.4)
P 		747.7
(3)
P 		225.1
(-3)
P 		523
avr 371
(-0.8) 		537.9
(1.8) 		616.7
(3) 		228.5
(-3) 		388

1 : 1 state (S1, L1)
2 : dauer (ST, LT)
6 450
1 2 3 4 5 6 range
A 146.6
(-3)
P 		415.6
(1.4)
P 		376.2
(0.8)
P 		509.5
(3)
P 		327.7
(-0)
P 		310
(-0.3)
P 		363
B 478.5
(1.3)
P 		596.4
(3)
P 		175.8
(-3)
P 		399.1
(0.2)
P 		536.7
(2.1)
P 		531.2
(2.1)
P 		421
C 481.8
(1.7)
P 		391.2
(-0.3)
P 		343.6
(-1.4)
P 		270.7
(-3)
P 		537.7
(3)
P 		517.1
(2.5)
P 		267
avr 369
(-0.5) 		467.7
(3) 		298.5
(-3) 		393.1
(0.4) 		467.4
(3) 		452.8
(2.5) 		169
NetAffx Links Cluster Members
Consensus/Exemplar
Group Members
GeneChip Array Information
Probe Set ID 172649_x_at
GeneChip Array C. elegans Genome Array
Organism Common Name Nematode
Probe Design Information
Transcript ID(Array Design) affy.Ce.10111
Sequence Type Exemplar sequence
Representative Public ID F55G1.10 NCBI
Target Description F55G1.10 /REP_DB=WormBase Gene ID /WP=CE04501 /GB=AAB00647.1 /SUBMIT=ST.LOUIS /CHR=4 /FEA=Sanger Annotation /DEF=Histone
Cluster Evidence This cluster is supported by a Sanger Annotation.
Annotation Method Description
Annotation Description This probe set was annotated using the Matching Probes based pipeline to a RefSeq identifier using 1 transcript(s).
Annotation Grade This is a grade A annotation.
Annotation Transcript Cluster (# of Matching Probes) NM_068800(11)
Transcript Assignments
Representative
Transcript		 Description Matching Probes Related Probesets by Grade
NM_068800 NCBI Caenorhabditis elegans F55G1.10 (Histone) mRNA, complete cds. 11/11 None
SNAP00000005171 ENSEMBL cdna:SNAP chromosome:CEL140:IV:7485818:7486201:-1 11/11 None
GENEFINDER00000005180 ENSEMBL cdna:GeneFinder chromosome:CEL140:IV:7485818:7486201:-1 11/11 None
F55G1.10 ENSEMBL cdna:known chromosome:CEL140:IV:7485732:7486201:-1 gene:F55G1.10 11/11 None
Annotation Notes
Cross Hybridizing mRNA Matched Probes Nature of Assignment Related Probesets by Grade
NM_072876 2/11 Cross Hyb Matching Probes A B 
NM_072892 2/11 Cross Hyb Matching Probes A B 
NM_072797 1/11 Cross Hyb Matching Probes A B 
NM_069003 3/11 Cross Hyb Matching Probes A B 
NM_069007 3/11 Cross Hyb Matching Probes A B 
NM_069749 4/11 Cross Hyb Matching Probes A B 
NM_064486 1/11 Cross Hyb Matching Probes A B 
NM_064490 1/11 Cross Hyb Matching Probes A B 
NM_064497 1/11 Cross Hyb Matching Probes A B 
NM_072879 2/11 Cross Hyb Matching Probes A B 
NM_074631 1/11 Cross Hyb Matching Probes A B 
NM_060241 2/11 Cross Hyb Matching Probes A B 
NM_069730 4/11 Cross Hyb Matching Probes A B 
NM_069740 4/11 Cross Hyb Matching Probes A B 
NM_072895 2/11 Cross Hyb Matching Probes A B 
SNAP00000036752 3/11 Cross Hyb Matching Probes None
GENEFINDER00000036755 3/11 Cross Hyb Matching Probes None
SNAP00000009812 1/11 Cross Hyb Matching Probes None
SNAP00000009816 1/11 Cross Hyb Matching Probes None
GENEFINDER00000009836 1/11 Cross Hyb Matching Probes None
GENEFINDER00000009839 1/11 Cross Hyb Matching Probes None
SNAP00000034713 1/11 Cross Hyb Matching Probes None
GENEFINDER00000034721 1/11 Cross Hyb Matching Probes None
SNAP00000000481 3/11 Cross Hyb Matching Probes None
GENEFINDER00000000494 3/11 Cross Hyb Matching Probes None
SNAP00000002624 4/11 Cross Hyb Matching Probes None
GENEFINDER00000002630 4/11 Cross Hyb Matching Probes None
SNAP00000035837 4/11 Cross Hyb Matching Probes None
GENEFINDER00000035847 4/11 Cross Hyb Matching Probes None
SNAP00000036324 4/11 Cross Hyb Matching Probes None
GENEFINDER00000036332 4/11 Cross Hyb Matching Probes None
SNAP00000039431 3/11 Cross Hyb Matching Probes None
GENEFINDER00000039433 3/11 Cross Hyb Matching Probes None
SNAP00000015093 2/11 Cross Hyb Matching Probes None
SNAP00000015096 2/11 Cross Hyb Matching Probes None
GENEFINDER00000015145 2/11 Cross Hyb Matching Probes None
GENEFINDER00000015151 2/11 Cross Hyb Matching Probes None
SNAP00000018184 2/11 Cross Hyb Matching Probes None
SNAP00000018187 2/11 Cross Hyb Matching Probes None
GENEFINDER00000018197 2/11 Cross Hyb Matching Probes None
GENEFINDER00000018200 2/11 Cross Hyb Matching Probes None
SNAP00000027915 1/11 Cross Hyb Matching Probes None
GENEFINDER00000027922 1/11 Cross Hyb Matching Probes None
SNAP00000030772 1/11 Cross Hyb Matching Probes None
GENEFINDER00000030788 1/11 Cross Hyb Matching Probes None
T23D8.6 3/11 Cross Hyb Matching Probes A B 
ZK131.10 1/11 Cross Hyb Matching Probes A B 
ZK131.6 1/11 Cross Hyb Matching Probes A B 
F08G2.2 1/11 Cross Hyb Matching Probes A B 
F35H10.1 3/11 Cross Hyb Matching Probes A B 
F17E9.13 3/11 Cross Hyb Matching Probes A B 
B0035.7 4/11 Cross Hyb Matching Probes A B 
F54E12.5 4/11 Cross Hyb Matching Probes A B 
H02I12.7 4/11 Cross Hyb Matching Probes A B 
F45F2.4 1/11 Cross Hyb Matching Probes A B 
F07B7.10 2/11 Cross Hyb Matching Probes A B 
F07B7.3 2/11 Cross Hyb Matching Probes A B 
K06C4.3 2/11 Cross Hyb Matching Probes A B 
K06C4.11 2/11 Cross Hyb Matching Probes A B 
T10C6.12 1/11 Cross Hyb Matching Probes A B 
Genomic Alignment of Consensus/Exemplar Sequence
Assembly Wormbase March 2004
Alignment(s)
Position Identity Coverage Cytoband
chrI:9997183-9997567(+) 94.27 94.27
chrII:13827219-13827602(+) 91.67 91.67
chrIV:11401068-11401452(+) 96.35 96.35
chrIV:11340388-11340772(+) 96.35 96.35
chrIV:8331653-8332037(+) 94.53 94.53
chrV:8898352-8898735(+) 91.67 91.67
chrV:8856257-8856640(+) 91.67 91.67
chrV:8535968-8536351(+) 91.41 91.41
chrII:13817653-13818037(-) 91.93 91.93
chrII:13821092-13821475(-) 91.67 91.67
chrIV:7485823-7486207(-) 100.0 100.0
chrIV:11324032-11324416(-) 96.35 96.35
chrIV:8335322-8335706(-) 94.53 94.53
chrV:8894471-8894854(-) 91.67 91.67
chrV:8852376-8852759(-) 91.67 91.67
Public Domain and Genome References
Gene Title Histone
Gene Symbol his-61
Ensembl F55G1.10
Entrez Gene 177521 Entrez gene
SwissProt P09588 EMBL-EBI
WormBase CE04501 Wormbase
Functional Annotations
Ortholog
ID Title Organism
ATH1-121501:264188_AT histone H2A, putative at
YEAST_2:1777647_S_AT One of two nearly identical (see also HTA2) histone H2A subtypes; core histone required for chromatin assembly and chromosome function; DNA damage-dependent phosphorylation by Mec1p facilitates DNA repair; acetylated by Nat4p Sc
YEAST_2:1780233_AT One of two nearly identical (see also HTA2) histone H2A subtypes; core histone required for chromatin assembly and chromosome function; DNA damage-dependent phosphorylation by Mec1p facilitates DNA repair; acetylated by Nat4p Sc
Gene Ontology
GO Biological Process (view graph)
ID Description Evidence Links
6334 nucleosome assembly inferred from electronic annotation QuickGO AmiGO
7001 chromosome organization and biogenesis (sensu Eukaryota) inferred from electronic annotation QuickGO AmiGO
GO Cellular Component (view graph)
ID Description Evidence Links
786 nucleosome inferred from electronic annotation QuickGO AmiGO
5634 nucleus inferred from electronic annotation QuickGO AmiGO
GO Molecular Function (view graph)
ID Description Evidence Links
3677 DNA binding inferred from electronic annotation QuickGO AmiGO
Protein Similarities
Method ID Description E-Value
blast CAE60212 Hypothetical protein CBG03776 [Caenorhabditis briggsae] 9.0E-42
blast CAB05838 Hypothetical protein ZK131.10 [Caenorhabditis elegans] emb|CAB05836.1| Hypothetical protein ZK131.6 [Caenorhabditis elegans] emb|CAB03399.1| Hypothetical protein T23D8.6 [Caenorhabditis elegans] emb|CAA97414.1| Hypothetical protein B0035.7 [Caenorhabditis elegans] emb|CAB07656.1| Hypothetical protein T10C6.12 [Caenorhabditis elegans] emb|CAB07221.1| Hypothetical protein H02I12.7 [Caenorhabditis elegans] emb|CAB05212.1| Hypothetical protein F54E12.5 [Caenorhabditis elegans] emb|CAB04056.1| Hypothetical protein F08G2.2 [Caenorhabditis elegans] gb|AAC05100.1| Histone protein 33 [Caenorhabditis elegans] gb|AAK84512.1| Histone protein 53 [Caenorhabditis elegans] gb|AAK84506.1| Histone protein 51 [Caenorhabditis elegans] gb|AAF98219.1| Histone protein 21 [Caenorhabditis elegans] gb|AAF98222.1| Histone protein 19 [Caenorhabditis elegans] emb|CAA33641.1| histone protein [Caenorhabditis elegans] gb|AAB00647.1| Histone protein 61 [Caenorhabditis elegans] gb|AAA81686.1| Histone protein 30 [Caenorhabditis elegans] gb|AAC48024.1| Histone protein 7 [Caenorhabditis elegans] ref|NP_505296.1| HIStone family member (his-19) [Caenorhabditis elegans] ref|NP_501408.1| HIStone family member (his-33) [Caenorhabditis elegans] ref|NP_501404.1| HIStone family member (his-30) [Caenorhabditis elegans] ref|NP_505198.1| HIStone family member (his-7) [Caenorhabditis elegans] ref|NP_502150.1| HIStone family member (his-65) [Caenorhabditis elegans] ref|NP_505280.1| HIStone family member (his-53) [Caenorhabditis elegans] ref|NP_507032.1| HIStone family member (his-3) [Caenorhabditis elegans] ref|NP_505293.1| HIStone family member (his-21) [Caenorhabditis elegans] ref|NP_505277.1| HIStone family member (his-51) [Caenorhabditis elegans] ref|NP_502141.1| HIStone family member (his-57) [Caenorhabditis elegans] ref|NP_502131.1| HIStone family member (his-47) [Caenorhabditis elegans] ref|NP_501201.1| F55G1.10 [Caenorhabditis elegans] ref|NP_496898.1| HIStone family member (his-43) [Caenorhabditis elegans] ref|NP_496891.1| HIStone family member (his-12) [Caenorhabditis elegans] ref|NP_496887.1| HIStone family member (his-16) [Caenorhabditis elegans] ref|NP_492642.1| HIStone family member (his-68) [Caenorhabditis elegans] sp|P09588|H2A_CAEEL Histone H2A emb|CAE62045.1| Hypothetical protein CBG06061 [Caenorhabditis briggsae] emb|CAE61892.1| Hypothetical protein CBG05883 [Caenorhabditis briggsae] emb|CAE61866.1| Hypothetical protein CBG05844 [Caenorhabditis briggsae] emb|CAE75451.1| Hypothetical protein CBG23445 [Caenorhabditis briggsae] emb|CAE75446.1| Hypothetical protein CBG23440 [Caenorhabditis briggsae] emb|CAE75442.1| Hypothetical protein CBG23436 [Caenorhabditis briggsae] emb|CAE65734.1| Hypothetical protein CBG10817 [Caenorhabditis briggsae] emb|CAE58377.1| Hypothetical protein CBG01506 [Caenorhabditis briggsae] 1.0E-41
blast CAE58371 Hypothetical protein CBG01498 [Caenorhabditis briggsae] 3.0E-41
Protein Domains
Database ID Description E-Value
Pfam IPR007125 EMBL-EBI Histone core 3.6E-55
Sequence
Target Sequence 
>C. ELEGANS:172649_X_AT
agctggacttcaattcccagtcggtcgtcttcatcgtattcttcgcaaaggaaactatgc
tcaacgtgttggagccggagctccagtttacttggccgctgttcttgaatacctcgctgc
tgaggttctcgaattggccggtaatgctgcccgtgacaacaagaagacccgtatcgcccc
aagacatcttcaactcgctgtccgaaacgacgaggagctcaacaagcttttggccggagt
gaccatcgcccaaggaggagttcttccaaatatccaagctg

BLASTn GenBank NR
Probe Info
Probe Sequence(5'-3') Probe X Probe Y Probe Interrogation
Position 		Strandedness
AGCTGGACTTCAATTCCCAGTCGGT 361 81 78 Antisense
TCGTCTTCATCGTATTCTTCGCAAA 390 605 102 Antisense
TACTTGGCCGCTGTTCTTGAATACC 670 643 166 Antisense
GAATACCTCGCTGCTGAGGTTCTCG 16 327 184 Antisense
GTTCTCGAATTGGCCGGTAATGCTG 558 441 202 Antisense
GTAATGCTGCCCGTGACAACAAGAA 79 463 218 Antisense
GACAACAAGAAGACCCGTATCGCCC 150 365 232 Antisense
TCTTCAACTCGCTGTCCGAAACGAC 511 611 264 Antisense
GGAGCTCAACAAGCTTTTGGCCGGA 293 521 291 Antisense
GTGACCATCGCCCAAGGAGGAGTTC 487 481 316 Antisense
GGAGTTCTTCCAAATATCCAAGCTG 554 517 334 Antisense
Sequence Source Affymetrix Proprietary Database