[Home] | [Total List]

[172647_x_at] --- /// histone H3 /// histone H3

Description K06C4.13 /REP_DB=WormBase Gene ID /WP=CE03253 /GEN=his-27 /SUBMIT=ST.LOUIS /CHR=5 /FEA=Sanger Annotation /DEF=histone H3
Cluster 6grp_highest_10_10 > 78      6grp_high1_10_10 > 96      4grp_highest_8_8 > 06      4grp_high_8_8 > 22      6grp_highest_nonorm > 48      6grp_total > 87      4grp_total > 17      6grp_highest_sub > In      6grp_cgc > 58      6grp_high1_sub > In      6grp_cgc_sub > In      6grp_total_sub > Increase      

Scale
G range Absolute graph Relative graph Expression Table Dauer Comp.
4 4179
1 2 3 4 range
A 3573.1
(-3)
P 		5362.9
(0.3)
P 		4534.1
(-1.2)
P 		6845.6
(3)
P 		3273
B 3466.2
(-3)
P 		4661
(-1.3)
P 		4709.1
(-1.2)
P 		7645.3
(3)
P 		4179
C 4113.8
(-2.8)
P 		4903.2
(-1.5)
P 		3994.5
(-3)
P 		7576.3
(3)
P 		3582
avr 3717.7
(-3) 		4975.7
(-0.9) 		4412.6
(-1.9) 		7355.7
(3) 		3638

1 : 1 state (S1, L1)
2 : dauer (ST, LT)
6 2882
1 2 3 4 5 6 range
A 3079
(-1.7)
P 		2766
(-3)
P 		3452.9
(-0.1)
P 		2952.7
(-2.2)
P 		3679.1
(0.8)
P 		4205.9
(3)
P 		1440
B 2865.7
(-3)
P 		2858
(-3)
P 		3988
(0.3)
P 		3744.8
(-0.4)
P 		3570.9
(-0.9)
P 		4911.4
(3)
P 		2053
C 2366.5
(-3)
P 		2883.3
(-1.9)
P 		2389
(-3)
P 		2689.2
(-2.3)
P 		3989.9
(0.4)
P 		5248.3
(3)
P 		2882
avr 2770.4
(-3) 		2835.8
(-2.8) 		3276.6
(-1.5) 		3128.9
(-1.9) 		3746.6
(-0.1) 		4788.5
(3) 		2018
No Scale
G range Absolute graph Relative graph Expression Table Dauer Comp.
4 627
1 2 3 4 range
A 1301
(3)
P 		1164.1
(0.3)
P 		1185.3
(0.7)
P 		1002.1
(-3)
P 		299
B 1105.3
(-2.8)
P 		1151.2
(-2.3)
P 		1091.2
(-3)
P 		1629.2
(3)
P 		538
C 1361.8
(0.8)
P 		1409.7
(3)
P 		1392.2
(2.2)
P 		1277.5
(-3)
P 		132
avr 1256
(-0.5) 		1241.7
(-1.6) 		1222.9
(-3) 		1302.9
(3) 		80

1 : 1 state (S1, L1)
2 : dauer (ST, LT)
6 1291
1 2 3 4 5 6 range
A 567.6
(-3)
P 		983.7
(1.6)
P 		752
(-1)
P 		748.9
(-1)
P 		1110.2
(3)
P 		1024
(2)
P 		543
B 997.1
(-2.7)
P 		951.3
(-3)
P 		968.4
(-2.9)
P 		991.9
(-2.7)
P 		1450.8
(0.4)
P 		1831.4
(3)
P 		880
C 877.1
(-1.3)
P 		879.8
(-1.3)
P 		608
(-2.7)
P 		540.8
(-3)
P 		1291.1
(0.7)
P 		1756.9
(3)
P 		1216
avr 813.9
(-2.6) 		938.3
(-1.6) 		776.1
(-2.9) 		760.5
(-3) 		1284
(1) 		1537.4
(3) 		777
NetAffx Links Cluster Members
Consensus/Exemplar
Group Members
GeneChip Array Information
Probe Set ID 172647_x_at
GeneChip Array C. elegans Genome Array
Organism Common Name Nematode
Probe Design Information
Transcript ID(Array Design) affy.Ce.12259
Sequence Type Exemplar sequence
Representative Public ID K06C4.13 NCBI
Target Description K06C4.13 /REP_DB=WormBase Gene ID /WP=CE03253 /GEN=his-27 /SUBMIT=ST.LOUIS /CHR=5 /FEA=Sanger Annotation /DEF=histone H3
Cluster Evidence This cluster is supported by a Sanger Annotation.
Annotation Method Description
Annotation Description This probe set was annotated using the Matching Probes based pipeline to a RefSeq identifier using 1 transcript(s).
Annotation Grade This is a grade A annotation.
Annotation Transcript Cluster (# of Matching Probes) NM_072896(11), NM_072875(11), NM_072891(11)
Transcript Assignments
Representative
Transcript		 Description Matching Probes Related Probesets by Grade
NM_072896 NCBI Caenorhabditis elegans HIStone family member (his-17) (his-17) mRNA, complete cds. 11/11 None
NM_072875 NCBI Caenorhabditis elegans HIStone family member (his-49) (his-49) mRNA, complete cds. 11/11 None
NM_072891 NCBI Caenorhabditis elegans HIStone family member (his-27) (his-27) mRNA, complete cds. 11/11 None
SNAP00000015092 ENSEMBL cdna:SNAP chromosome:CEL140:V:8850530:8850940:1 11/11 None
GENEFINDER00000015146 ENSEMBL cdna:GeneFinder chromosome:CEL140:V:8850530:8850940:1 11/11 None
SNAP00000018183 ENSEMBL cdna:SNAP chromosome:CEL140:V:8892625:8893035:1 11/11 None
SNAP00000018188 ENSEMBL cdna:SNAP chromosome:CEL140:V:8900169:8900579:-1 11/11 None
GENEFINDER00000018196 ENSEMBL cdna:GeneFinder chromosome:CEL140:V:8900169:8900579:-1 11/11 None
GENEFINDER00000018198 ENSEMBL cdna:GeneFinder chromosome:CEL140:V:8892625:8893035:1 11/11 None
F07B7.5 ENSEMBL cdna:known chromosome:CEL140:V:8850530:8850940:1 gene:F07B7.5 11/11 None
K06C4.13 ENSEMBL cdna:known chromosome:CEL140:V:8892625:8893035:1 gene:K06C4.13 11/11 None
K06C4.5 ENSEMBL cdna:known chromosome:CEL140:V:8900112:8900579:-1 gene:K06C4.5 11/11 None
Annotation Notes
Cross Hybridizing mRNA Matched Probes Nature of Assignment Related Probesets by Grade
NM_069752 1/11 Cross Hyb Matching Probes A 
NM_067207 1/11 Cross Hyb Matching Probes A B 
NM_072798 7/11 Cross Hyb Matching Probes A B 
NM_074632 3/11 Cross Hyb Matching Probes A B 
NM_069733 1/11 Cross Hyb Matching Probes A 
NM_069006 1/11 Cross Hyb Matching Probes A B 
NM_069737 1/11 Cross Hyb Matching Probes A 
SNAP00000016068 1/11 Cross Hyb Matching Probes None
GENEFINDER00000016112 1/11 Cross Hyb Matching Probes None
SNAP00000000480 1/11 Cross Hyb Matching Probes None
GENEFINDER00000000500 1/11 Cross Hyb Matching Probes None
SNAP00000002621 1/11 Cross Hyb Matching Probes None
GENEFINDER00000002632 1/11 Cross Hyb Matching Probes None
SNAP00000028586 1/11 Cross Hyb Matching Probes None
GENEFINDER00000028598 1/11 Cross Hyb Matching Probes None
SNAP00000035840 1/11 Cross Hyb Matching Probes None
GENEFINDER00000035856 1/11 Cross Hyb Matching Probes None
SNAP00000027916 3/11 Cross Hyb Matching Probes None
GENEFINDER00000027930 3/11 Cross Hyb Matching Probes None
SNAP00000030773 7/11 Cross Hyb Matching Probes None
GENEFINDER00000030784 7/11 Cross Hyb Matching Probes None
GENEFINDER00000013875 3/11 Cross Hyb Matching Probes None
SNAP00000013868 3/11 Cross Hyb Matching Probes None
Y49E10.6.2 1/11 Cross Hyb Matching Probes None
Y49E10.6.1 1/11 Cross Hyb Matching Probes None
F17E9.10 1/11 Cross Hyb Matching Probes A B 
B0035.10 1/11 Cross Hyb Matching Probes A 
F54E12.1 1/11 Cross Hyb Matching Probes A 
F22B3.2 1/11 Cross Hyb Matching Probes A 
F45F2.13 7/11 Cross Hyb Matching Probes A B 
T10C6.13 3/11 Cross Hyb Matching Probes A B 
K03A1.1 3/11 Cross Hyb Matching Probes B 
Genomic Alignment of Consensus/Exemplar Sequence
Assembly Wormbase March 2004
Alignment(s)
Position Identity Coverage Cytoband
chrII:13823541-13823952(+) 90.02 90.02
chrII:13820103-13820514(+) 90.02 90.02
chrV:8892625-8893036(+) 100.0 100.0
chrV:8850530-8850941(+) 100.0 100.0
chrX:7310054-7310464(+) 97.32 97.32
chrII:13824742-13825153(-) 90.02 90.02
chrV:8900169-8900580(-) 99.76 99.76
chrV:8537155-8537566(-) 99.03 99.03
chrV:16044455-16044866(-) 96.84 96.84
Public Domain and Genome References
Gene Title
histone H3
histone H3
Gene Symbol his-49
his-27
his-17
Ensembl F07B7.5
K06C4.13
K06C4.5
Entrez Gene 184113 Entrez gene
191673 Entrez gene
246024 Entrez gene
SwissProt P08898 EMBL-EBI
WormBase CE03253 Wormbase
CE03253 Wormbase
CE03253 Wormbase
Functional Annotations
Ortholog
ID Title Organism
ATH1-121501:250433_AT histone H3 at
ATH1-121501:250433_AT histone H3 at
CANINE_2:CFAAFFX.945.1.S1_S_AT similar to histone 1, H2ai (predicted) cfa
CANINE_2:CFAAFFX.945.1.S1_S_AT similar to histone 1, H2ai (predicted) cfa
DROSOPHILA_2:1638308_S_AT dm
DROSOPHILA_2:1626867_AT dm
DROSOPHILA_2:1638308_S_AT dm
DROSOPHILA_2:1626867_AT dm
CHICKEN:GGA.5576.1.S1_A_AT germinal histone H4 gene gga
CHICKEN:GGA.5576.1.S1_A_AT similar to germinal histone H4 gene gga
CHICKEN:GGA.5576.2.S1_AT similar to germinal histone H4 gene gga
CHICKEN:GGAAFFX.23666.1.A1_AT similar to germinal histone H4 gene gga
CHICKEN:GGA.5576.1.S1_A_AT similar to histone protein Hist2h3c1 gga
CHICKEN:GGA.6103.1.S1_AT similar to histone protein Hist2h3c1 gga
CHICKEN:GGA.6103.1.S1_X_AT similar to histone protein Hist2h3c1 gga
CHICKEN:GGA.5576.1.S1_A_AT germinal histone H4 gene gga
CHICKEN:GGA.5576.1.S1_A_AT similar to germinal histone H4 gene gga
CHICKEN:GGA.5576.2.S1_AT similar to germinal histone H4 gene gga
CHICKEN:GGAAFFX.23666.1.A1_AT similar to germinal histone H4 gene gga
CHICKEN:GGA.5576.1.S1_A_AT similar to histone protein Hist2h3c1 gga
CHICKEN:GGA.6103.1.S1_AT similar to histone protein Hist2h3c1 gga
CHICKEN:GGA.6103.1.S1_X_AT similar to histone protein Hist2h3c1 gga
HG-U133_PLUS_2:208496_X_AT histone 1, H3g hs
HG-U133A:208496_X_AT histone 1, H3g hs
HG-FOCUS:208496_X_AT histone 1, H3g hs
HG-U133A_2:208496_X_AT histone 1, H3g hs
U133_X3P:G4504290_3P_X_AT histone 1, H3g hs
U133_X3P:G4504290_3P_AT histone 1, H3g hs
HG-U133_PLUS_2:208496_X_AT histone 1, H3g hs
HG-U133A:208496_X_AT histone 1, H3g hs
HG-FOCUS:208496_X_AT histone 1, H3g hs
HG-U133A_2:208496_X_AT histone 1, H3g hs
U133_X3P:G4504290_3P_X_AT histone 1, H3g hs
U133_X3P:G4504290_3P_AT histone 1, H3g hs
MOE430A:1460314_S_AT histone 2, H3c1 mm
MOUSE430_2:1460314_S_AT histone 2, H3c1 mm
MOUSE430A_2:1460314_S_AT histone 2, H3c1 mm
MG-U74AV2:94756_AT histone 2, H3c1 mm
MOUSE430A_2:1427864_AT histone 2, H3c1 mm
MOE430A:1427864_AT histone 2, H3c1 mm
MOUSE430_2:1427864_AT histone 2, H3c1 mm
MU11KSUBA:M32461_S_AT histone 2, H3c1 mm
MOE430A:1431231_AT histone 2, H3c1 mm
MOUSE430A_2:1431231_AT histone 2, H3c1 mm
MOUSE430_2:1431231_AT histone 2, H3c1 mm
MOE430B:1442051_AT histone 2, H3c1 mm
MOUSE430_2:1442051_AT histone 2, H3c1 mm
MG-U74CV2:169241_I_AT histone 2, H3c1 mm
MOE430A:1460314_S_AT histone 2, H3c1 mm
MOUSE430_2:1460314_S_AT histone 2, H3c1 mm
MOUSE430A_2:1460314_S_AT histone 2, H3c1 mm
MG-U74AV2:94756_AT histone 2, H3c1 mm
MOUSE430A_2:1427864_AT histone 2, H3c1 mm
MOE430A:1427864_AT histone 2, H3c1 mm
MOUSE430_2:1427864_AT histone 2, H3c1 mm
MU11KSUBA:M32461_S_AT histone 2, H3c1 mm
MOE430A:1431231_AT histone 2, H3c1 mm
MOUSE430A_2:1431231_AT histone 2, H3c1 mm
MOUSE430_2:1431231_AT histone 2, H3c1 mm
MOE430B:1442051_AT histone 2, H3c1 mm
MOUSE430_2:1442051_AT histone 2, H3c1 mm
MG-U74CV2:169241_I_AT histone 2, H3c1 mm
RAE230B:1384367_AT similar to histone protein Hist2h3c1 rn
RAT230_2:1384367_AT similar to histone protein Hist2h3c1 rn
RAE230B:1384367_AT similar to histone protein Hist2h3c1 rn
RAT230_2:1384367_AT similar to histone protein Hist2h3c1 rn
Gene Ontology
GO Biological Process (view graph)
ID Description Evidence Links
6334 nucleosome assembly inferred from electronic annotation QuickGO AmiGO
7001 chromosome organization and biogenesis (sensu Eukaryota) inferred from electronic annotation QuickGO AmiGO
GO Cellular Component (view graph)
ID Description Evidence Links
786 nucleosome inferred from electronic annotation QuickGO AmiGO
5634 nucleus inferred from electronic annotation QuickGO AmiGO
GO Molecular Function (view graph)
ID Description Evidence Links
3677 DNA binding inferred from electronic annotation QuickGO AmiGO
Protein Similarities
Method ID Description E-Value
blast CAB05834 Hypothetical protein ZK131.7 [Caenorhabditis elegans] emb|CAB05833.1| Hypothetical protein ZK131.3 [Caenorhabditis elegans] emb|CAB05831.1| Hypothetical protein ZK131.2 [Caenorhabditis elegans] emb|CAA97411.1| Hypothetical protein B0035.10 [Caenorhabditis elegans] emb|CAA92733.1| Hypothetical protein F22B3.2 [Caenorhabditis elegans] emb|CAB07653.1| Hypothetical protein T10C6.13 [Caenorhabditis elegans] emb|CAB05209.1| Hypothetical protein F54E12.1 [Caenorhabditis elegans] emb|CAB04057.1| Hypothetical protein F08G2.3 [Caenorhabditis elegans] gb|AAC05102.1| Histone protein 32 [Caenorhabditis elegans] gb|AAK84514.1| Histone protein 49 [Caenorhabditis elegans] gb|AAF98226.1| Histone protein 17 [Caenorhabditis elegans] gb|AAF98231.1| Histone protein 27 [Caenorhabditis elegans] emb|CAA33644.1| Histone protein [Caenorhabditis elegans] gb|AAB00650.1| Histone protein 59 [Caenorhabditis elegans] gb|AAC48033.1| Histone protein 6 [Caenorhabditis elegans] ref|NP_505292.1| HIStone family member (his-27) [Caenorhabditis elegans] ref|NP_505297.1| HIStone family member (his-17) [Caenorhabditis elegans] ref|NP_496890.1| HIStone family member (his-13) [Caenorhabditis elegans] ref|NP_505199.1| HIStone family member (his-6) [Caenorhabditis elegans] ref|NP_501204.1| F55G1.2 [Caenorhabditis elegans] ref|NP_502138.1| HIStone family member (his-55) [Caenorhabditis elegans] ref|NP_502153.1| HIStone family member (his-63) [Caenorhabditis elegans] ref|NP_496899.1| HIStone family member (his-42) [Caenorhabditis elegans] ref|NP_505276.1| HIStone family member (his-49) [Caenorhabditis elegans] ref|NP_502134.1| HIStone family member (his-45) [Caenorhabditis elegans] ref|NP_507033.1| HIStone family member (his-2) [Caenorhabditis elegans] ref|NP_501407.1| HIStone family member (his-32) [Caenorhabditis elegans] ref|NP_496895.1| HIStone family member (his-25) [Caenorhabditis elegans] ref|NP_496894.1| HIStone family member (his-9) [Caenorhabditis elegans] gb|AAG50235.1| histone H3 [Caenorhabditis elegans] pir||HSKW3 histone H3 - Caenorhabditis elegans 5.0E-70
Protein Domains
Database ID Description E-Value
Pfam IPR007125 EMBL-EBI Histone core 1.6E-29
Sequence
Target Sequence 
>C. ELEGANS:172647_X_AT
aaagcagttggccaccaaggccgctcgcaagtctgctccagcctctgggggagttaagaa
gccacatcgttaccgtccaggaaccgtcgctcttcgtgagatcagacgttaccagaagtc
taccgagctcctcatccgcagagcgccattccagcgtcttgttcgtgagatcgctcaaga
tttcaagaccgatcttcgcttccaatcttccgctgtcatggctcttcaagaggctgccga
ggcatacctcgtcggactcttcgaggacaccaacttgtgcgcaatccacgccaagcgagt
caccatcatgccaaaggac

BLASTn GenBank NR
Probe Info
Probe Sequence(5'-3') Probe X Probe Y Probe Interrogation
Position 		Strandedness
AAAGCAGTTGGCCACCAAGGCCGCT 543 121 66 Antisense
CTGCTCCAGCCTCTGGGGGAGTTAA 299 237 98 Antisense
GTTAAGAAGCCACATCGTTACCGTC 56 367 118 Antisense
GTCGCTCTTCGTGAGATCAGACGTT 422 475 151 Antisense
ACGTTACCAGAAGTCTACCGAGCTC 165 95 171 Antisense
ATTCCAGCGTCTTGTTCGTGAGATC 435 7 213 Antisense
AGATTTCAAGACCGATCTTCGCTTC 608 65 243 Antisense
AGAGGCTGCCGAGGCATACCTCGTC 319 67 294 Antisense
ATACCTCGTCGGACTCTTCGAGGAC 706 21 309 Antisense
GAGGACACCAACTTGTGCGCAATCC 299 405 328 Antisense
GCGAGTCACCATCATGCCAAAGGAC 191 291 360 Antisense
Sequence Source Affymetrix Proprietary Database