[Home] | [Total List]

[172629_x_at]

Description Y59E9AR.7 /REP_DB=WormBase Gene ID /WP=CE22666 /TR=Q9N2M1 /GB=AAF60826.1 /SUBMIT=ST.LOUIS /CHR=4 /FEA=Sanger Annotation
Cluster 6grp_total > 98      4grp_total > 17      6grp_total_sub > Increase      6grp_rule_based > S6      4grp_rule_based > L4      

Scale
G range Absolute graph Relative graph Expression Table Dauer Comp.
4 563
1 2 3 4 range
A 139.1
(-3)
A 		234.6
(-2)
A 		293.9
(-1.3)
A 		685.1
(3)
A 		546
B 191.9
(-3)
A 		296.6
(1.7)
M 		307.3
(2.2)
A 		325
(3)
A 		133
C 198.9
(-3)
A 		268.9
(-2.2)
A 		198.7
(-3)
A 		702.4
(3)
M 		504
avr 176.6
(-3) 		266.7
(-1.6) 		266.6
(-1.6) 		570.8
(3) 		394

1 : 1 state (S1, L1)
2 : dauer (ST, LT)
6 14238
1 2 3 4 5 6 range
A 164.6
(-3)
A 		124.1
(-3)
A 		372.7
(-2.9)
P 		1373
(-2.5)
P 		9408.3
(0.9)
P 		14362
(3)
P 		14238
B 139.1
(-3)
A 		252
(-2.9)
P 		257.8
(-2.9)
A 		1088.7
(-2.5)
P 		10821.7
(2.9)
P 		10970.3
(3)
P 		10831
C 213.2
(-3)
A 		453.7
(-2.9)
P 		187.3
(-3)
A 		949.8
(-2.6)
P 		11906.7
(3)
P 		11736.3
(2.9)
P 		11719
avr 172.3
(-3) 		276.6
(-2.9) 		272.6
(-3) 		1137.2
(-2.5) 		10712.2
(2.2) 		12356.2
(3) 		12184
No Scale
G range Absolute graph Relative graph Expression Table Dauer Comp.
4 68
1 2 3 4 range
A 50.7
(-3)
A 		50.9
(-3)
A 		76.8
(0.2)
A 		100.3
(3)
A 		50
B 61.2
(-3)
A 		73.2
(3)
M 		71.2
(2)
A 		69.3
(1.1)
A 		12
C 65.8
(-3)
A 		77.3
(-1.7)
A 		69.3
(-2.6)
A 		118.4
(3)
M 		53
avr 59.2
(-3) 		67.1
(-1.7) 		72.4
(-0.8) 		96
(3) 		37

1 : 1 state (S1, L1)
2 : dauer (ST, LT)
6 4366
1 2 3 4 5 6 range
A 30.3
(-3)
A 		44.1
(-3)
A 		81.2
(-2.9)
P 		348.2
(-2.4)
P 		2839
(1.9)
P 		3496.7
(3)
P 		3466
B 48.4
(-3)
A 		83.9
(-3)
P 		62.6
(-3)
A 		288.4
(-2.7)
P 		4396.7
(3)
P 		4090.8
(2.6)
P 		4348
C 79
(-3)
A 		138.4
(-2.9)
P 		47.7
(-3)
A 		191
(-2.8)
P 		3852.8
(2.9)
P 		3928.8
(3)
P 		3881
avr 52.6
(-3) 		88.8
(-2.9) 		63.8
(-3) 		275.9
(-2.6) 		3696.2
(2.8) 		3838.8
(3) 		3786
NetAffx Links Cluster Members
Consensus/Exemplar
Group Members
GeneChip Array Information
Probe Set ID 172629_x_at
GeneChip Array C. elegans Genome Array
Organism Common Name Nematode
Probe Design Information
Transcript ID(Array Design) affy.Ce.10639
Sequence Type Exemplar sequence
Representative Public ID Y59E9AR.7 NCBI
Target Description Y59E9AR.7 /REP_DB=WormBase Gene ID /WP=CE22666 /TR=Q9N2M1 /GB=AAF60826.1 /SUBMIT=ST.LOUIS /CHR=4 /FEA=Sanger Annotation
Annotation Method Description
Annotation Description This probe set was annotated using the Matching Probes based pipeline to a RefSeq identifier using 1 transcript(s).
Annotation Grade This is a grade A annotation.
Annotation Transcript Cluster (# of Matching Probes) NM_068351(11), NM_068354(11)
Transcript Assignments
Representative
Transcript		 Description Matching Probes Related Probesets by Grade
NM_068351 NCBI Caenorhabditis elegans Y59E9AR.7 (Y59E9AR.7) mRNA, complete cds. 11/11 None
NM_068354 NCBI Caenorhabditis elegans Y59E9AR.1 (Y59E9AR.1) mRNA, complete cds. 11/11 None
SNAP00000034129 ENSEMBL cdna:SNAP chromosome:CEL140:IV:5241391:5241783:-1 11/11 None
SNAP00000034134 ENSEMBL cdna:SNAP chromosome:CEL140:IV:5249417:5249809:1 11/11 None
GENEFINDER00000034137 ENSEMBL cdna:GeneFinder chromosome:CEL140:IV:5249417:5249809:1 11/11 None
GENEFINDER00000034140 ENSEMBL cdna:GeneFinder chromosome:CEL140:IV:5241391:5241783:-1 11/11 None
Y59E9AR.7 ENSEMBL cdna:known chromosome:CEL140:IV:5241391:5241783:-1 gene:Y59E9AR.7 11/11 None
Y59E9AR.1 ENSEMBL cdna:known chromosome:CEL140:IV:5249417:5249809:1 gene:Y59E9AR.1 11/11 None
Annotation Notes
Cross Hybridizing mRNA Matched Probes Nature of Assignment Related Probesets by Grade
NM_062497 1/11 Cross Hyb Matching Probes A 
NM_068370 7/11 Cross Hyb Matching Probes A 
NM_068310 6/11 Cross Hyb Matching Probes A 
NM_068312 6/11 Cross Hyb Matching Probes A 
NM_068313 7/11 Cross Hyb Matching Probes A 
NM_069063 3/11 Cross Hyb Matching Probes A 
NM_062558 1/11 Cross Hyb Matching Probes A 
NM_068359 7/11 Cross Hyb Matching Probes A 
NM_068377 7/11 Cross Hyb Matching Probes A 
NM_068379 3/11 Cross Hyb Matching Probes A 
NM_062743 1/11 Cross Hyb Matching Probes A 
NM_062748 1/11 Cross Hyb Matching Probes A 
NM_062753 1/11 Cross Hyb Matching Probes A 
NM_069321 1/11 Cross Hyb Matching Probes A 
NM_069339 1/11 Cross Hyb Matching Probes A 
NM_069341 1/11 Cross Hyb Matching Probes A 
NM_069358 1/11 Cross Hyb Matching Probes A 
NM_069359 1/11 Cross Hyb Matching Probes A 
NM_069361 1/11 Cross Hyb Matching Probes A 
NM_069380 1/11 Cross Hyb Matching Probes A 
NM_068372 4/11 Cross Hyb Matching Probes A 
SNAP00000024816 1/11 Cross Hyb Matching Probes None
GENEFINDER00000024829 1/11 Cross Hyb Matching Probes None
SNAP00000019951 1/11 Cross Hyb Matching Probes None
GENEFINDER00000019958 1/11 Cross Hyb Matching Probes None
SNAP00000031245 1/11 Cross Hyb Matching Probes None
GENEFINDER00000031258 1/11 Cross Hyb Matching Probes None
SNAP00000041369 1/11 Cross Hyb Matching Probes None
SNAP00000041374 1/11 Cross Hyb Matching Probes None
GENEFINDER00000041386 1/11 Cross Hyb Matching Probes None
GENEFINDER00000041398 1/11 Cross Hyb Matching Probes None
SNAP00000043876 1/11 Cross Hyb Matching Probes None
SNAP00000002639 7/11 Cross Hyb Matching Probes None
SNAP00000002641 3/11 Cross Hyb Matching Probes None
GENEFINDER00000002656 3/11 Cross Hyb Matching Probes None
GENEFINDER00000002661 7/11 Cross Hyb Matching Probes None
SNAP00000004243 1/11 Cross Hyb Matching Probes None
SNAP00000004244 1/11 Cross Hyb Matching Probes None
SNAP00000004246 1/11 Cross Hyb Matching Probes None
GENEFINDER00000004263 1/11 Cross Hyb Matching Probes None
GENEFINDER00000004265 1/11 Cross Hyb Matching Probes None
GENEFINDER00000004273 1/11 Cross Hyb Matching Probes None
SNAP00000006004 7/11 Cross Hyb Matching Probes None
SNAP00000006006 4/11 Cross Hyb Matching Probes None
SNAP00000006011 2/11 Cross Hyb Matching Probes None
SNAP00000006013 7/11 Cross Hyb Matching Probes None
SNAP00000006015 3/11 Cross Hyb Matching Probes None
GENEFINDER00000006018 2/11 Cross Hyb Matching Probes None
GENEFINDER00000006020 7/11 Cross Hyb Matching Probes None
GENEFINDER00000006021 7/11 Cross Hyb Matching Probes None
GENEFINDER00000006023 4/11 Cross Hyb Matching Probes None
GENEFINDER00000006024 3/11 Cross Hyb Matching Probes None
SNAP00000007231 6/11 Cross Hyb Matching Probes None
GENEFINDER00000007236 6/11 Cross Hyb Matching Probes None
SNAP00000023386 1/11 Cross Hyb Matching Probes None
GENEFINDER00000023395 1/11 Cross Hyb Matching Probes None
SNAP00000029404 6/11 Cross Hyb Matching Probes None
SNAP00000029405 7/11 Cross Hyb Matching Probes None
GENEFINDER00000029413 6/11 Cross Hyb Matching Probes None
GENEFINDER00000029416 7/11 Cross Hyb Matching Probes None
SNAP00000029847 3/11 Cross Hyb Matching Probes None
GENEFINDER00000029849 3/11 Cross Hyb Matching Probes None
SNAP00000041533 1/11 Cross Hyb Matching Probes None
GENEFINDER00000041543 1/11 Cross Hyb Matching Probes None
SNAP00000043472 1/11 Cross Hyb Matching Probes None
SNAP00000043475 1/11 Cross Hyb Matching Probes None
GENEFINDER00000043484 1/11 Cross Hyb Matching Probes None
GENEFINDER00000043489 1/11 Cross Hyb Matching Probes None
SNAP00000043994 3/11 Cross Hyb Matching Probes None
GENEFINDER00000044007 2/11 Cross Hyb Matching Probes None
R05F9.13 1/11 Cross Hyb Matching Probes A 
F59A6.8 1/11 Cross Hyb Matching Probes None
F58A6.8 1/11 Cross Hyb Matching Probes A 
K05F1.2 1/11 Cross Hyb Matching Probes A 
ZK1248.6 1/11 Cross Hyb Matching Probes A 
ZK1248.4 1/11 Cross Hyb Matching Probes A 
C09B9.6 6/11 Cross Hyb Matching Probes A 
R13H9.2 6/11 Cross Hyb Matching Probes A 
R13H9.4 7/11 Cross Hyb Matching Probes A 
F36H12.7 7/11 Cross Hyb Matching Probes A 
F36H12.6 2/11 Cross Hyb Matching Probes None
ZK354.5 7/11 Cross Hyb Matching Probes A 
ZK354.4 4/11 Cross Hyb Matching Probes A 
ZK354.10 3/11 Cross Hyb Matching Probes None
ZK354.11 7/11 Cross Hyb Matching Probes A 
ZK354.1 3/11 Cross Hyb Matching Probes A 
Y59H11AM.1 3/11 Cross Hyb Matching Probes A 
ZK1251.6 1/11 Cross Hyb Matching Probes A 
T13F2.10 1/11 Cross Hyb Matching Probes A 
T13F2.11 1/11 Cross Hyb Matching Probes A 
K07F5.1 1/11 Cross Hyb Matching Probes A 
K07F5.2 1/11 Cross Hyb Matching Probes A 
K07F5.3 1/11 Cross Hyb Matching Probes A 
F32B6.6 1/11 Cross Hyb Matching Probes A 
C04G2.3 1/11 Cross Hyb Matching Probes None
Genomic Alignment of Consensus/Exemplar Sequence
Assembly Wormbase March 2004
Alignment(s)
Position Identity Coverage Cytoband
chrIV:5249422-5249815(+) 100.0 100.0
chrIV:5260586-5260967(+) 95.93 95.93
chrIV:5062576-5062957(+) 95.17 95.17
chrIV:5297959-5298340(+) 93.89 93.89
chrIV:5316520-5316901(+) 93.38 93.38
chrIV:8571428-8571809(+) 92.37 92.37
chrIV:9770028-9770409(+) 90.59 90.59
chrIV:10093059-10093457(+) 91.09 91.09
chrII:5012855-5013237(-) 90.84 90.84
chrII:4892294-4892675(-) 90.59 90.59
chrII:4916162-4916543(-) 90.59 90.59
chrIV:5241396-5241789(-) 100.0 100.0
chrIV:5064673-5065054(-) 95.93 95.93
chrIV:5312722-5313103(-) 95.67 95.67
chrIV:5294951-5295332(-) 95.17 95.17
chrIV:5055626-5056007(-) 94.91 94.91
chrIV:5457295-5457674(-) 92.62 92.62
chrIV:9836013-9836394(-) 90.84 90.84
chrIV:9766750-9767131(-) 90.59 90.59
chrIV:10143333-10143714(-) 90.59 90.59
Public Domain and Genome References
Gene Title

Ensembl Y59E9AR.7
Y59E9AR.1
Entrez Gene 177300 Entrez gene
177301 Entrez gene
SwissProt Q9N2M1 EMBL-EBI
WormBase CE22666 Wormbase
CE22666 Wormbase
Functional Annotations
Gene Ontology
GO Molecular Function (view graph)
ID Description Evidence Links
5198 structural molecule activity inferred from electronic annotation QuickGO AmiGO
Protein Similarities
Method ID Description E-Value
blast AAF60826 Hypothetical protein Y59E9AR.7 [Caenorhabditis elegans] gb|AAF60828.1| Hypothetical protein Y59E9AR.1 [Caenorhabditis elegans] ref|NP_500755.1| Y59E9AR.1 [Caenorhabditis elegans] ref|NP_500752.1| Y59E9AR.7 [Caenorhabditis elegans] 2.0E-73
blast AAA68736 Hypothetical protein ZK546.3 [Caenorhabditis elegans] ref|NP_494906.1| ZK546.3 [Caenorhabditis elegans] 6.0E-71
blast AAA85761 Major sperm protein protein 50 [Caenorhabditis elegans] emb|CAA94282.1| Hypothetical protein K07F5.1 [Caenorhabditis elegans] gb|AAK85493.1| Major sperm protein protein 53 [Caenorhabditis elegans] gb|AAB42254.1| Major sperm protein protein 51 [Caenorhabditis elegans] gb|AAB42255.1| Major sperm protein protein 113 [Caenorhabditis elegans] gb|AAB42253.1| Major sperm protein protein 59 [Caenorhabditis elegans] gb|AAB42256.1| Major sperm protein protein 65 [Caenorhabditis elegans] gb|AAC71087.1| Major sperm protein protein 64 [Caenorhabditis elegans] gb|AAA68711.1| Major sperm protein protein 142 [Caenorhabditis elegans] gb|AAA96204.1| Major sperm protein protein 45 [Caenorhabditis elegans] gb|AAC26926.1| Major sperm protein protein 19 [Caenorhabditis elegans] ref|NP_500773.1| Major Sperm Protein family member (msp-113) [Caenorhabditis elegans] ref|NP_500771.1| Major Sperm Protein family member (msp-51) [Caenorhabditis elegans] ref|NP_501759.1| Major Sperm Protein family member (msp-81) [Caenorhabditis elegans] ref|NP_500780.1| Major Sperm Protein family member (msp-65) [Caenorhabditis elegans] ref|NP_500778.1| Major Sperm Protein family member (msp-59) [Caenorhabditis elegans] ref|NP_500760.1| Major Sperm Protein family member (msp-19) [Caenorhabditis elegans] ref|NP_500714.1| Major Sperm Protein family member (msp-53) [Caenorhabditis elegans] ref|NP_495149.1| Major Sperm Protein family member (msp-64) [Caenorhabditis elegans] ref|NP_495144.1| Major Sperm Protein family member (msp-142) [Caenorhabditis elegans] ref|NP_494972.1| Major Sperm Protein family member (msp-50) [Caenorhabditis elegans] ref|NP_494959.1| Major Sperm Protein family member (msp-45) [Caenorhabditis elegans] ref|NP_494898.1| Major Sperm Protein family member (msp-31) [Caenorhabditis elegans] ref|NP_494865.1| Major Sperm Protein family member (msp-40) [Caenorhabditis elegans] gb|AAK31477.1| Major sperm protein protein 40 [Caenorhabditis elegans] gb|AAA83175.1| Major sperm protein protein 31 [Caenorhabditis elegans] sp|P53017|MSP19_CAEEL Major sperm protein 19/31/40/45/50/51/53/59/61/65/81/113/142 (MSP) 6.0E-71
Protein Domains
Database ID Description E-Value
Pfam IPR000535 EMBL-EBI Major sperm protein (MSP) domain 4.7E-35
Sequence
Target Sequence 
>C. ELEGANS:172629_X_AT
tctgtcccaccaggagacatccaaacccagccgggtaccaagattgtgttcaatgcccca
tacgacgacaaacacacctaccacatcaaggtgatcaactcatcggctcgccgtattgga
tacggtatcaagaccaccaatatgaagagacttggagttgatccaccatgtggagttctc
gacccaaaggaagcagttcttcttgccgtttcctgtgatgctttcgcctttggacaagaa
gacaccaacaacgatcgtatcactgttgagtggaccaacaccccagatggagctgccaag
caattccgccgtgaatggttccaa

BLASTn GenBank NR
Probe Info
Probe Sequence(5'-3') Probe X Probe Y Probe Interrogation
Position 		Strandedness
TCTGTCCCACCAGGAGACATCCAAA 24 609 31 Antisense
ACCCAGCCGGGTACCAAGATTGTGT 616 89 55 Antisense
TCAATGCCCCATACGACGACAAACA 381 633 80 Antisense
ATCAACTCATCGGCTCGCCGTATTG 57 27 124 Antisense
ACCATGTGGAGTTCTCGACCCAAAG 512 83 195 Antisense
AAGGAAGCAGTTCTTCTTGCCGTTT 542 159 217 Antisense
TGATGCTTTCGCCTTTGGACAAGAA 97 565 246 Antisense
GAAGACACCAACAACGATCGTATCA 699 339 268 Antisense
ACTGTTGAGTGGACCAACACCCCAG 490 97 292 Antisense
AGATGGAGCTGCCAAGCAATTCCGC 44 69 315 Antisense
GCAATTCCGCCGTGAATGGTTCCAA 206 317 330 Antisense
Sequence Source Affymetrix Proprietary Database