|
|
Cluster Members Consensus/Exemplar Group Members |
GeneChip Array Information |
|
172613_x_at |
|
C. elegans Genome Array |
|
Nematode |
Probe Design Information |
|
affy.Ce.9402
|
|
Exemplar sequence
|
|
Y62E10A.12 NCBI
|
|
Y62E10A.12 /REP_DB=WormBase Gene ID /WP=CE28143 /TR=Q9U1W8 /GB=CAB60606.2 /SUBMIT=HINXTON /CHR=4 /FEA=Sanger Annotation
|
Annotation Method Description |
|
This probe set was annotated using the Matching Probes based pipeline to a RefSeq identifier using 1 transcript(s). |
|
This is a grade A annotation. |
|
NM_070178(11) |
|
|
|
|
|
NM_070178 NCBI |
Caenorhabditis elegans LSM Sm-like protein family member (lsm-3) (lsm-3) mRNA, complete cds. |
11/11 |
None |
SNAP00000008081 ENSEMBL |
cdna:SNAP chromosome:CEL140:IV:13387438:13389004:1 |
11/11 |
None |
GENEFINDER00000008093 ENSEMBL |
cdna:GeneFinder chromosome:CEL140:IV:13387438:13389004:1 |
11/11 |
None |
Y62E10A.12.1 ENSEMBL |
cdna:known chromosome:CEL140:IV:13387172:13389086:1 gene:Y62E10A.12 |
11/11 |
None |
Y62E10A.12.2 ENSEMBL |
cdna:known chromosome:CEL140:IV:13387438:13389199:1 gene:Y62E10A.12 |
11/11 |
None | |
There are no noteworthy cross hybridizing mRNAs found for this probe set. | |
Genomic Alignment of Consensus/Exemplar Sequence |
|
Wormbase March 2004 |
|
|
|
|
|
chrIV:13387443-13387682(+) |
100.0 |
100.0 |
| |
Public Domain and Genome References |
|
|
|
lsm-3
|
|
Y62E10A.12
|
|
178303 Entrez gene
|
|
Q9U1W8 EMBL-EBI
|
|
CE28143 Wormbase
|
Functional Annotations |
|
|
|
|
ATH1-121501:256333_AT |
small nuclear ribonucleoprotein, putative / snRNP, putative / Sm protein, putative |
at |
CANINE:1583873_AT |
similar to LSM3 homolog, U6 small nuclear RNA associated |
cfa |
CANINE_2:CFAAFFX.4877.1.S1_X_AT |
similar to LSM3 homolog, U6 small nuclear RNA associated |
cfa |
CANINE_2:CFAAFFX.7588.1.S1_X_AT |
similar to LSM3 homolog, U6 small nuclear RNA associated |
cfa |
CANINE_2:CFAAFFX.7654.1.S1_S_AT |
similar to LSM3 homolog, U6 small nuclear RNA associated |
cfa |
DROSOPHILA_2:1639108_AT |
|
dm |
DROSGENOME1:150476_AT |
|
dm |
CHICKEN:GGA.1101.1.S1_A_AT |
similar to U6 snRNA-associated Sm-like protein LSm3 (MDS017) |
gga |
CHICKEN:GGA.1101.2.S1_AT |
similar to U6 snRNA-associated Sm-like protein LSm3 (MDS017) |
gga |
HG-U133_PLUS_2:202209_AT |
LSM3 homolog, U6 small nuclear RNA associated (S. cerevisiae) |
hs |
HG-U133A:202209_AT |
LSM3 homolog, U6 small nuclear RNA associated (S. cerevisiae) |
hs |
HG-FOCUS:202209_AT |
LSM3 homolog, U6 small nuclear RNA associated (S. cerevisiae) |
hs |
HG-U133A_2:202209_AT |
LSM3 homolog, U6 small nuclear RNA associated (S. cerevisiae) |
hs |
HU35KSUBA:RC_AA461098_S_AT |
LSM3 homolog, U6 small nuclear RNA associated (S. cerevisiae) |
hs |
HU35KSUBA:AA421213_AT |
LSM3 homolog, U6 small nuclear RNA associated (S. cerevisiae) |
hs |
U133_X3P:G7657314_3P_AT |
LSM3 homolog, U6 small nuclear RNA associated (S. cerevisiae) |
hs |
HG-U95AV2:39009_AT |
LSM3 homolog, U6 small nuclear RNA associated (S. cerevisiae) |
hs |
MU11KSUBA:AA462343_S_AT |
LSM3 homolog, U6 small nuclear RNA associated (S. cerevisiae) |
mm |
MG-U74AV2:94455_AT |
LSM3 homolog, U6 small nuclear RNA associated (S. cerevisiae) |
mm |
MOE430A:1448536_AT |
LSM3 homolog, U6 small nuclear RNA associated (S. cerevisiae) |
mm |
MOUSE430A_2:1448536_AT |
LSM3 homolog, U6 small nuclear RNA associated (S. cerevisiae) |
mm |
MOUSE430_2:1448536_AT |
LSM3 homolog, U6 small nuclear RNA associated (S. cerevisiae) |
mm |
RG-U34B:RC_AA946082_AT |
LSM3 homolog, U6 small nuclear RNA associated (S. cerevisiae) (predicted) |
rn |
RAE230A:1388488_AT |
LSM3 homolog, U6 small nuclear RNA associated (S. cerevisiae) (predicted) |
rn |
RAT230_2:1388488_AT |
LSM3 homolog, U6 small nuclear RNA associated (S. cerevisiae) (predicted) |
rn | |
|
|
|
|
|
6397 |
mRNA processing |
inferred from electronic annotation |
QuickGO AmiGO |
|
|
|
|
5634 |
nucleus |
inferred from electronic annotation |
QuickGO AmiGO |
5732 |
small nucleolar ribonucleoprotein complex |
inferred from electronic annotation |
QuickGO AmiGO |
30529 |
ribonucleoprotein complex |
inferred from electronic annotation |
QuickGO AmiGO | |
|
|
|
|
|
blast |
CAB60606 |
Hypothetical protein Y62E10A.12 [Caenorhabditis elegans] ref|NP_502579.1| LSM Sm-like protein family member (lsm-3) [Caenorhabditis elegans] |
6.0E-50 |
blast |
CAE58609 |
Hypothetical protein CBG01776 [Caenorhabditis briggsae] |
3.0E-48 |
blast |
CAB60606 |
Hypothetical protein Y62E10A.12 [Caenorhabditis elegans] ref|NP_502579.1| LSM Sm-like protein family member (lsm-3) [Caenorhabditis elegans] |
7.0E-44 |
blast |
CAE58609 |
Hypothetical protein CBG01776 [Caenorhabditis briggsae] |
3.0E-42 | |
|
|
|
|
|
Pfam |
IPR001163 EMBL-EBI |
Small nuclear ribonucleoprotein (Sm protein) |
3.3E-25 |
Pfam |
IPR001163 EMBL-EBI |
Small nuclear ribonucleoprotein (Sm protein) |
9.2E-14 |
Pfam |
IPR001163 EMBL-EBI |
Small nuclear ribonucleoprotein (Sm protein) |
1.1E-4 | |
Sequence |
|
>C. ELEGANS:172613_X_AT
gaaagaagtgacactgtctgctacagtcgaagagccactcgatttgctccgtctcagttt
ggatgagagagtttatgtcaaaatgagaaacgacagagagttgcgcggtcgtctcagagc
tttcgatcaacatttgaac
BLASTn GenBank NR |
|
|
|
|
|
|
GAAAGAAGTGACACTGTCTGCTACA |
369 |
359 |
27 |
Antisense |
GAAGTGACACTGTCTGCTACAGTCG |
656 |
335 |
31 |
Antisense |
GTGACACTGTCTGCTACAGTCGAAG |
68 |
483 |
34 |
Antisense |
GTCTGCTACAGTCGAAGAGCCACTC |
543 |
471 |
42 |
Antisense |
GCTACAGTCGAAGAGCCACTCGATT |
178 |
299 |
46 |
Antisense |
GTCGAAGAGCCACTCGATTTGCTCC |
481 |
473 |
52 |
Antisense |
ATTTGCTCCGTCTCAGTTTGGATGA |
327 |
17 |
68 |
Antisense |
GAGAAACGACAGAGAGTTGCGCGGT |
238 |
387 |
111 |
Antisense |
ACGACAGAGAGTTGCGCGGTCGTCT |
293 |
93 |
116 |
Antisense |
GGTCGTCTCAGAGCTTTCGATCAAC |
363 |
503 |
133 |
Antisense |
CAGAGCTTTCGATCAACATTTGAAC |
589 |
203 |
141 |
Antisense | |
|
Affymetrix Proprietary Database |