[Home] | [Total List]

[172471_x_at]

Description ZC178.2 /REP_DB=WormBase Gene ID /WP=CE15064 /TR=O17084 /GB=AAB70340.1 /SUBMIT=ST.LOUIS /CHR=5 /FEA=Sanger Annotation
Cluster 6grp_total > 43      4grp_total > 02      4grp_rule_based > L4      

Scale
G range Absolute graph Relative graph Expression Table Dauer Comp.
4 66
1 2 3 4 range
A 20.9
(-1.5)
A 		5.2
(-3)
A 		15.4
(-2)
A 		66
(3)
P 		61
B 2.6
(-3)
A 		31
(3)
A 		16.6
(-0)
A 		21.5
(1)
A 		28
C 13.5
(-1.9)
A 		1.5
(-3)
A 		1.7
(-3)
A 		67.7
(3)
P 		66
avr 12.3
(-2.8) 		12.6
(-2.8) 		11.2
(-3) 		51.7
(3) 		41

1 : 1 state (S1, L1)
2 : dauer (ST, LT)
6 28
1 2 3 4 5 6 range
A 28.9
(3)
A 		2.6
(-2.7)
A 		10.1
(-1.1)
A 		1.1
(-3)
A 		4
(-2.4)
A 		1.9
(-2.8)
A 		28
B 3.9
(-1.6)
A 		1.7
(-3)
A 		10.3
(2.4)
A 		8
(0.9)
A 		11.3
(3)
A 		6
(-0.3)
A 		10
C 7.4
(-1.5)
A 		12.6
(0)
A 		23.2
(3)
A 		4.6
(-2.3)
A 		2
(-3)
A 		9.6
(-0.8)
A 		21
avr 13.4
(2.3) 		5.6
(-2.4) 		14.5
(3) 		4.6
(-3) 		5.8
(-2.3) 		5.8
(-2.3) 		10
No Scale
G range Absolute graph Relative graph Expression Table Dauer Comp.
4 11
1 2 3 4 range
A 7.6
(1.5)
A 		1.1
(-3)
A 		4
(-1)
A 		9.7
(3)
P 		9
B 0.8
(-3)
A 		7.7
(3)
A 		3.8
(-0.4)
A 		4.6
(0.3)
A 		7
C 4.5
(-0.8)
A 		0.4
(-3)
A 		0.6
(-2.9)
A 		11.4
(3)
P 		11
avr 4.3
(-1.4) 		3.1
(-2.7) 		2.8
(-3) 		8.6
(3) 		6

1 : 1 state (S1, L1)
2 : dauer (ST, LT)
6 6
1 2 3 4 5 6 range
A 5.3
(3)
A 		0.9
(-2.3)
A 		2.2
(-0.7)
A 		0.3
(-3)
A 		1.2
(-1.9)
A 		0.5
(-2.8)
A 		5
B 1.3
(-2)
A 		0.6
(-3)
A 		2.5
(-0.2)
A 		2.1
(-0.8)
A 		4.6
(3)
A 		2.2
(-0.6)
A 		4
C 2.7
(-0.6)
A 		3.8
(0.6)
A 		5.9
(3)
A 		0.9
(-2.7)
A 		0.6
(-3)
A 		3.2
(-0.1)
A 		5
avr 3.1
(2) 		1.8
(-1.3) 		3.5
(3) 		1.1
(-3) 		2.1
(-0.5) 		2
(-0.8) 		2
NetAffx Links Cluster Members
Consensus/Exemplar
Group Members
GeneChip Array Information
Probe Set ID 172471_x_at
GeneChip Array C. elegans Genome Array
Organism Common Name Nematode
Probe Design Information
Transcript ID(Array Design) affy.Ce.12301
Sequence Type Exemplar sequence
Representative Public ID ZC178.2 NCBI
Target Description ZC178.2 /REP_DB=WormBase Gene ID /WP=CE15064 /TR=O17084 /GB=AAB70340.1 /SUBMIT=ST.LOUIS /CHR=5 /FEA=Sanger Annotation
Annotation Method Description
Annotation Description This probe set was annotated using the Matching Probes based pipeline to a RefSeq identifier using 1 transcript(s).
Annotation Grade This is a grade A annotation.
Annotation Transcript Cluster (# of Matching Probes) NM_072842(11)
Transcript Assignments
Representative
Transcript		 Description Matching Probes Related Probesets by Grade
NM_072842 NCBI Caenorhabditis elegans ZC178.2 (ZC178.2) mRNA, complete cds. 11/11 None
SNAP00000009738 ENSEMBL cdna:SNAP chromosome:CEL140:V:8708025:8709122:-1 11/11 None
GENEFINDER00000009752 ENSEMBL cdna:GeneFinder chromosome:CEL140:V:8706680:8712491:-1 11/11 None
ZC178.2 ENSEMBL cdna:known chromosome:CEL140:V:8708025:8712468:-1 gene:ZC178.2 11/11 None
Annotation Notes
Cross Hybridizing mRNA Matched Probes Nature of Assignment Related Probesets by Grade
SNAP00000009739 5/11 Cross Hyb Matching Probes None
Genomic Alignment of Consensus/Exemplar Sequence
Assembly Wormbase March 2004
Alignment(s)
Position Identity Coverage Cytoband
chrV:8708025-8712469(-) 100.0 100.0
chrV:8708440-8712381(-) 83.61 83.61
chrV:8708329-8712381(-) 80.96 80.96
chrV:8709092-8712495(-) 63.9 63.9
chrV:8708066-8710645(-) 57.6 57.6
chrV:8709360-8712478(-) 55.02 55.02
chrV:8708109-8710417(-) 50.87 50.87
chrV:8709492-8712495(-) 50.5 50.5
chrV:8708095-8710274(-) 47.76 47.76
Public Domain and Genome References
Gene Title
Ensembl ZC178.2
Entrez Gene 191093 Entrez gene
SwissProt O17084 EMBL-EBI
WormBase CE15064 Wormbase
Functional Annotations
Ortholog
ID Title Organism
DROSOPHILA_2:1631700_AT dm
DROSOPHILA_2:1638341_S_AT dm
DROSOPHILA_2:1623469_S_AT dm
DROSGENOME1:148588_AT dm
Protein Similarities
Method ID Description E-Value
blast AAB70340 Hypothetical protein ZC178.2 [Caenorhabditis elegans] ref|NP_505243.1| ZC178.2 [Caenorhabditis elegans] 0.0
blast AAB70340 Hypothetical protein ZC178.2 [Caenorhabditis elegans] ref|NP_505243.1| ZC178.2 [Caenorhabditis elegans] 1.0E-124
blast NP_765804 streptococcal hemagglutinin protein [Staphylococcus epidermidis ATCC 12228] gb|AAO05891.1| streptococcal hemagglutinin protein [Staphylococcus epidermidis ATCC 12228] 6.0E-68
blast NP_765804 streptococcal hemagglutinin protein [Staphylococcus epidermidis ATCC 12228] gb|AAO05891.1| streptococcal hemagglutinin protein [Staphylococcus epidermidis ATCC 12228] 1.0E-67
blast CAE75525 Hypothetical protein CBG23547 [Caenorhabditis briggsae] 2.0E-67
blast BAE03635.1 unnamed protein product [Staphylococcus haemolyticus JCSC1435] ref|YP_252241.1| hypothetical protein SH0326 [Staphylococcus haemolyticus JCSC1435] 7.0E-67
Protein Domains
Database ID Description E-Value
Pfam IPR008519 EMBL-EBI C. elegans protein of unknown function DUF801 1.5E-12
Pfam IPR008519 EMBL-EBI C. elegans protein of unknown function DUF801 2.0E-15
Pfam IPR008519 EMBL-EBI C. elegans protein of unknown function DUF801 4.5E-13
Pfam IPR008519 EMBL-EBI C. elegans protein of unknown function DUF801 4.1E-12
Pfam IPR008519 EMBL-EBI C. elegans protein of unknown function DUF801 7.2E-14
Pfam IPR008519 EMBL-EBI C. elegans protein of unknown function DUF801 7.2E-14
Pfam IPR008519 EMBL-EBI C. elegans protein of unknown function DUF801 7.2E-14
Pfam IPR008519 EMBL-EBI C. elegans protein of unknown function DUF801 7.2E-14
Pfam IPR008519 EMBL-EBI C. elegans protein of unknown function DUF801 7.2E-14
Pfam IPR008519 EMBL-EBI C. elegans protein of unknown function DUF801 7.2E-14
Pfam IPR008519 EMBL-EBI C. elegans protein of unknown function DUF801 7.2E-14
Pfam IPR008519 EMBL-EBI C. elegans protein of unknown function DUF801 4.5E-13
Pfam IPR008519 EMBL-EBI C. elegans protein of unknown function DUF801 1.8E-15
Pfam IPR008519 EMBL-EBI C. elegans protein of unknown function DUF801 1.3E-14
Pfam IPR008519 EMBL-EBI C. elegans protein of unknown function DUF801 1.8E-15
Pfam IPR008519 EMBL-EBI C. elegans protein of unknown function DUF801 7.2E-14
Pfam IPR008519 EMBL-EBI C. elegans protein of unknown function DUF801 4.5E-13
Pfam IPR008519 EMBL-EBI C. elegans protein of unknown function DUF801 2.0E-15
Pfam IPR008519 EMBL-EBI C. elegans protein of unknown function DUF801 2.0E-15
Pfam IPR008519 EMBL-EBI C. elegans protein of unknown function DUF801 2.0E-15
Pfam IPR008519 EMBL-EBI C. elegans protein of unknown function DUF801 4.5E-13
Pfam IPR008519 EMBL-EBI C. elegans protein of unknown function DUF801 8.6E-15
Pfam IPR008519 EMBL-EBI C. elegans protein of unknown function DUF801 7.2E-14
Pfam IPR008519 EMBL-EBI C. elegans protein of unknown function DUF801 7.2E-14
Pfam IPR008519 EMBL-EBI C. elegans protein of unknown function DUF801 7.2E-14
Pfam IPR008519 EMBL-EBI C. elegans protein of unknown function DUF801 7.2E-14
Pfam IPR008519 EMBL-EBI C. elegans protein of unknown function DUF801 7.2E-14
Pfam IPR008519 EMBL-EBI C. elegans protein of unknown function DUF801 4.5E-13
Pfam IPR008519 EMBL-EBI C. elegans protein of unknown function DUF801 1.1E-16
Pfam IPR008519 EMBL-EBI C. elegans protein of unknown function DUF801 1.9E-10
Pfam IPR008519 EMBL-EBI C. elegans protein of unknown function DUF801 4.5E-13
Pfam IPR008519 EMBL-EBI C. elegans protein of unknown function DUF801 1.3E-14
Pfam IPR008519 EMBL-EBI C. elegans protein of unknown function DUF801 1.3E-14
Pfam IPR008519 EMBL-EBI C. elegans protein of unknown function DUF801 4.5E-13
Pfam IPR008519 EMBL-EBI C. elegans protein of unknown function DUF801 1.3E-14
Pfam IPR008519 EMBL-EBI C. elegans protein of unknown function DUF801 2.6E-14
Pfam IPR008519 EMBL-EBI C. elegans protein of unknown function DUF801 1.3E-14
Pfam IPR008519 EMBL-EBI C. elegans protein of unknown function DUF801 2.6E-14
Pfam IPR008519 EMBL-EBI C. elegans protein of unknown function DUF801 2.0E-15
Pfam IPR008519 EMBL-EBI C. elegans protein of unknown function DUF801 4.5E-13
Pfam IPR008519 EMBL-EBI C. elegans protein of unknown function DUF801 1.3E-14
Pfam IPR008519 EMBL-EBI C. elegans protein of unknown function DUF801 1.3E-14
Pfam IPR008519 EMBL-EBI C. elegans protein of unknown function DUF801 4.5E-13
Pfam IPR008519 EMBL-EBI C. elegans protein of unknown function DUF801 1.3E-14
Pfam IPR008519 EMBL-EBI C. elegans protein of unknown function DUF801 2.6E-14
Pfam IPR008519 EMBL-EBI C. elegans protein of unknown function DUF801 1.3E-14
Pfam IPR008519 EMBL-EBI C. elegans protein of unknown function DUF801 2.6E-14
Pfam IPR008519 EMBL-EBI C. elegans protein of unknown function DUF801 1.5E-12
Pfam IPR008519 EMBL-EBI C. elegans protein of unknown function DUF801 2.0E-15
Pfam IPR008519 EMBL-EBI C. elegans protein of unknown function DUF801 4.5E-13
Pfam IPR008519 EMBL-EBI C. elegans protein of unknown function DUF801 4.1E-12
Pfam IPR008519 EMBL-EBI C. elegans protein of unknown function DUF801 7.2E-14
Pfam IPR008519 EMBL-EBI C. elegans protein of unknown function DUF801 7.2E-14
Pfam IPR008519 EMBL-EBI C. elegans protein of unknown function DUF801 7.2E-14
Pfam IPR008519 EMBL-EBI C. elegans protein of unknown function DUF801 7.2E-14
Pfam IPR008519 EMBL-EBI C. elegans protein of unknown function DUF801 7.2E-14
Pfam IPR008519 EMBL-EBI C. elegans protein of unknown function DUF801 7.2E-14
Pfam IPR008519 EMBL-EBI C. elegans protein of unknown function DUF801 7.2E-14
Pfam IPR008519 EMBL-EBI C. elegans protein of unknown function DUF801 4.5E-13
Pfam IPR008519 EMBL-EBI C. elegans protein of unknown function DUF801 1.8E-15
Pfam IPR008519 EMBL-EBI C. elegans protein of unknown function DUF801 1.3E-14
Pfam IPR008519 EMBL-EBI C. elegans protein of unknown function DUF801 1.8E-15
Pfam IPR008519 EMBL-EBI C. elegans protein of unknown function DUF801 7.2E-14
Pfam IPR008519 EMBL-EBI C. elegans protein of unknown function DUF801 4.5E-13
Pfam IPR008519 EMBL-EBI C. elegans protein of unknown function DUF801 2.0E-15
Pfam IPR008519 EMBL-EBI C. elegans protein of unknown function DUF801 2.0E-15
Pfam IPR008519 EMBL-EBI C. elegans protein of unknown function DUF801 2.0E-15
Pfam IPR008519 EMBL-EBI C. elegans protein of unknown function DUF801 4.5E-13
Pfam IPR008519 EMBL-EBI C. elegans protein of unknown function DUF801 8.6E-15
Pfam IPR008519 EMBL-EBI C. elegans protein of unknown function DUF801 7.2E-14
Pfam IPR008519 EMBL-EBI C. elegans protein of unknown function DUF801 7.2E-14
Pfam IPR008519 EMBL-EBI C. elegans protein of unknown function DUF801 7.2E-14
Pfam IPR008519 EMBL-EBI C. elegans protein of unknown function DUF801 7.2E-14
Pfam IPR008519 EMBL-EBI C. elegans protein of unknown function DUF801 7.2E-14
Pfam IPR008519 EMBL-EBI C. elegans protein of unknown function DUF801 4.5E-13
Pfam IPR008519 EMBL-EBI C. elegans protein of unknown function DUF801 1.1E-16
Pfam IPR008519 EMBL-EBI C. elegans protein of unknown function DUF801 1.9E-10
Pfam IPR008519 EMBL-EBI C. elegans protein of unknown function DUF801 4.5E-13
Pfam IPR008519 EMBL-EBI C. elegans protein of unknown function DUF801 1.3E-14
Pfam IPR008519 EMBL-EBI C. elegans protein of unknown function DUF801 1.3E-14
Pfam IPR008519 EMBL-EBI C. elegans protein of unknown function DUF801 4.5E-13
Pfam IPR008519 EMBL-EBI C. elegans protein of unknown function DUF801 1.3E-14
Pfam IPR008519 EMBL-EBI C. elegans protein of unknown function DUF801 2.6E-14
Pfam IPR008519 EMBL-EBI C. elegans protein of unknown function DUF801 1.3E-14
Pfam IPR008519 EMBL-EBI C. elegans protein of unknown function DUF801 2.6E-14
Trans Membrane
ID Number Of Domains Domain Boundaries
GENEFINDER00000009752 1 1489-1511
Sequence
Target Sequence 
>C. ELEGANS:172471_X_AT
gcccatcgtctacagtcacaaattctgcaagtagtgagactccatgtaattctgaaacac
agacgtctgatggaacatccactatgacagtttcaagcgattcaactacagcaggcccat
cgtctacagtcacaaattctgcaagtagtgagactccatgtaattctgaaacacaaacgt
ctgatggaacatccactatgacagtttcaagcgattcaactacagcaggtcaatcgtcta
cagccacaaattctgcaagtagtgagactccatgtaattctgaaacacagacgtctgatg
gaacatccactatgacagtttcaagcgattcaactacagcaggcccatcgtctacagtca
caaattctgcaagtagtgagactccatgtaattctgaaacacaaacgtctgatggaacat
ccactatgacagtttcaagcgattcaactacagcaggtcaatcgtctacagccacaaatt
ctgcaagtagtgagactccatgtaattctgaaacacaaacgtctgataaaacatccacga
tgacatttccaagcgaatccactacagcagtttcaacgtct

BLASTn GenBank NR
Probe Info
Probe Sequence(5'-3') Probe X Probe Y Probe Interrogation
Position 		Strandedness
GCCCATCGTCTACAGTCACAAATTC 471 283 3782 Antisense
GGAACATCCACTATGACAGTTTCAA 362 529 3853 Antisense
CTACAGCAGGTCAATCGTCTACAGC 272 227 4001 Antisense
TCGTCTACAGCCACAAATTCTGCAA 45 605 4015 Antisense
GAACATCCACTATGACAGTTTCAAG 93 351 4082 Antisense
CAAGCGATTCAACTACAGCAGGCCC 618 185 4103 Antisense
CAAGCGATTCAACTACAGCAGGTCA 619 185 4217 Antisense
GTCAATCGTCTACAGCCACAAATTC 280 463 4238 Antisense
AACATCCACGATGACATTTCCAAGC 243 135 4311 Antisense
GACATTTCCAAGCGAATCCACTACA 233 371 4323 Antisense
ATCCACTACAGCAGTTTCAACGTCT 598 39 4338 Antisense
Sequence Source Affymetrix Proprietary Database