[Home] | [Total List]

[172197_x_at]

Description W05B2.1 /REP_DB=WormBase Gene ID /WP=CE20144 /TR=Q9U349 /GB=CAB03475.1 /SUBMIT=HINXTON /CHR=3 /FEA=Sanger Annotation
Cluster 6grp_highest_10_10 > 26      6grp_high1_10_10 > 52      4grp_highest_8_8 > 09      4grp_high_8_8 > 53      6grp_highest_nonorm > 09      6grp_total > 52      4grp_total > 58      6grp_highest_sub > 03      6grp_cgc > 73      6grp_high1_sub > 03      6grp_cgc_sub > 02_03      6grp_total_sub > Hat      6grp_rule_based > S3      4grp_rule_based > L2      

Scale
G range Absolute graph Relative graph Expression Table Dauer Comp.
4 39034
1 2 3 4 range
A 19497.4
(-0.3)
P 		41099.5
(3)
P 		37934
(2.5)
P 		2213.6
(-3)
P 		38886
B 19795.6
(-0.2)
P 		35809.3
(2.4)
P 		39512.6
(3)
P 		2065.6
(-3)
P 		37447
C 19595.3
(0.4)
P 		32799.9
(3)
P 		29405.5
(2.3)
P 		2330.9
(-3)
P 		30469
avr 19629.4
(0) 		36569.6
(3) 		35617.4
(2.8) 		2203.4
(-3) 		34366

1 : 1 state (S1, L1)
2 : dauer (ST, LT)
6 19221
1 2 3 4 5 6 range
A 25092.7
(-3)
P 		33367.2
(0.6)
P 		38731.6
(3)
P 		32085.6
(0.1)
P 		27850
(-1.8)
P 		25864.2
(-2.7)
P 		13639
B 23049.9
(-1.9)
P 		30571.6
(1.1)
P 		35374.4
(3)
P 		30261.9
(1)
P 		26821.3
(-0.4)
P 		20368.8
(-3)
P 		15006
C 23331
(-1.5)
P 		32314
(1.9)
P 		35226.3
(3)
P 		32802
(2.1)
P 		32377.3
(1.9)
P 		19510.5
(-3)
P 		15716
avr 23824.5
(-2.2) 		32084.3
(1.2) 		36444.1
(3) 		31716.5
(1) 		29016.2
(-0.1) 		21914.5
(-3) 		14530
No Scale
G range Absolute graph Relative graph Expression Table Dauer Comp.
4 9925
1 2 3 4 range
A 7099
(1.2)
P 		8921.6
(2.4)
P 		9916.7
(3)
P 		324
(-3)
P 		9593
B 6312.6
(1)
P 		8844.1
(2.8)
P 		9156
(3)
P 		440.2
(-3)
P 		8716
C 6486.6
(0.7)
P 		9430.2
(2.5)
P 		10248.7
(3)
P 		393
(-3)
P 		9856
avr 6632.7
(1) 		9065.3
(2.5) 		9773.8
(3) 		385.7
(-3) 		9388

1 : 1 state (S1, L1)
2 : dauer (ST, LT)
6 7241
1 2 3 4 5 6 range
A 4625.6
(-3)
P 		11867
(3)
P 		8434.9
(0.2)
P 		8137.7
(-0.1)
P 		8403.9
(0.1)
P 		6297.1
(-1.6)
P 		7241
B 8020.2
(-2.2)
P 		10176
(1.7)
P 		8590
(-1.2)
P 		8015.3
(-2.2)
P 		10897.1
(3)
P 		7595.4
(-3)
P 		3302
C 8647.8
(0.2)
P 		9860
(2.1)
P 		8965.7
(0.7)
P 		6596.5
(-2.9)
P 		10476.8
(3)
P 		6531.3
(-3)
P 		3946
avr 7097.9
(-2.5) 		10634.3
(3) 		8663.5
(-0.1) 		7583.2
(-1.8) 		9925.9
(1.9) 		6807.9
(-3) 		3826
NetAffx Links Cluster Members
Consensus/Exemplar
Group Members
GeneChip Array Information
Probe Set ID 172197_x_at
GeneChip Array C. elegans Genome Array
Organism Common Name Nematode
Probe Design Information
Transcript ID(Array Design) affy.Ce.6714
Sequence Type Exemplar sequence
Representative Public ID W05B2.1 NCBI
Target Description W05B2.1 /REP_DB=WormBase Gene ID /WP=CE20144 /TR=Q9U349 /GB=CAB03475.1 /SUBMIT=HINXTON /CHR=3 /FEA=Sanger Annotation
Annotation Method Description
Annotation Description This probe set was annotated using the Matching Probes based pipeline to a RefSeq identifier using 1 transcript(s).
Annotation Grade This is a grade A annotation.
Annotation Transcript Cluster (# of Matching Probes) NM_067009(11), NM_067007(11)
Transcript Assignments
Representative
Transcript		 Description Matching Probes Related Probesets by Grade
NM_067009 NCBI Caenorhabditis elegans COLlagen family member (col-94) (col-94) mRNA, complete cds. 11/11 A 
NM_067007 NCBI Caenorhabditis elegans COLlagen family member (col-92) (col-92) mRNA, complete cds. 11/11 A 
SNAP00000036390 ENSEMBL cdna:SNAP chromosome:CEL140:III:10982077:10983163:-1 11/11 None
GENEFINDER00000036401 ENSEMBL cdna:GeneFinder chromosome:CEL140:III:10982077:10983103:-1 11/11 None
SNAP00000036392 ENSEMBL cdna:SNAP chromosome:CEL140:III:10986744:10987707:-1 11/11 None
GENEFINDER00000036395 ENSEMBL cdna:GeneFinder chromosome:CEL140:III:10986744:10987707:-1 11/11 None
W05B2.6 ENSEMBL cdna:known chromosome:CEL140:III:10982043:10983130:-1 gene:W05B2.6 11/11 A 
W05B2.1 ENSEMBL cdna:known chromosome:CEL140:III:10986703:10987720:-1 gene:W05B2.1 11/11 A 
Annotation Notes
Cross Hybridizing mRNA Matched Probes Nature of Assignment Related Probesets by Grade
NM_067008 7/11 Cross Hyb Matching Probes A 
NM_181982 2/11 Cross Hyb Matching Probes None
NM_073276 1/11 Cross Hyb Matching Probes A 
NM_073277 1/11 Cross Hyb Matching Probes A 
NM_073694 1/11 Cross Hyb Matching Probes A 
NM_069466 1/11 Cross Hyb Matching Probes A 
NM_067504 1/11 Cross Hyb Matching Probes A 
NM_064730 1/11 Cross Hyb Matching Probes A 
NM_069125 2/11 Cross Hyb Matching Probes A 
NM_069126 2/11 Cross Hyb Matching Probes A 
NM_072337 1/11 Cross Hyb Matching Probes A 
NM_069160 1/11 Cross Hyb Matching Probes A 
NM_072974 2/11 Cross Hyb Matching Probes A 
NM_070299 2/11 Cross Hyb Matching Probes A 
NM_076346 1/11 Cross Hyb Matching Probes A 
NM_075994 1/11 Cross Hyb Matching Probes A 
NM_067302 1/11 Cross Hyb Matching Probes A 
NM_073882 1/11 Cross Hyb Matching Probes A 
NM_073883 1/11 Cross Hyb Matching Probes A 
NM_073899 1/11 Cross Hyb Matching Probes A 
NM_073501 1/11 Cross Hyb Matching Probes A 
NM_073933 1/11 Cross Hyb Matching Probes A 
NM_072335 1/11 Cross Hyb Matching Probes A 
NM_069706 2/11 Cross Hyb Matching Probes A 
NM_068118 1/11 Cross Hyb Matching Probes A 
NM_066328 1/11 Cross Hyb Matching Probes None
NM_063909 1/11 Cross Hyb Matching Probes A 
SNAP00000014221 1/11 Cross Hyb Matching Probes None
GENEFINDER00000014237 1/11 Cross Hyb Matching Probes None
SNAP00000036391 8/11 Cross Hyb Matching Probes None
GENEFINDER00000036400 8/11 Cross Hyb Matching Probes None
SNAP00000017782 1/11 Cross Hyb Matching Probes None
SNAP00000034887 3/11 Cross Hyb Matching Probes None
GENEFINDER00000034916 2/11 Cross Hyb Matching Probes None
SNAP00000000290 1/11 Cross Hyb Matching Probes None
GENEFINDER00000000294 1/11 Cross Hyb Matching Probes None
SNAP00000003708 1/11 Cross Hyb Matching Probes None
GENEFINDER00000003712 1/11 Cross Hyb Matching Probes None
SNAP00000005654 2/11 Cross Hyb Matching Probes None
SNAP00000005655 2/11 Cross Hyb Matching Probes None
GENEFINDER00000005663 2/11 Cross Hyb Matching Probes None
GENEFINDER00000005664 2/11 Cross Hyb Matching Probes None
SNAP00000015232 1/11 Cross Hyb Matching Probes None
GENEFINDER00000015234 1/11 Cross Hyb Matching Probes None
SNAP00000023158 1/11 Cross Hyb Matching Probes None
GENEFINDER00000023159 1/11 Cross Hyb Matching Probes None
SNAP00000035582 2/11 Cross Hyb Matching Probes None
GENEFINDER00000035589 2/11 Cross Hyb Matching Probes None
SNAP00000037122 2/11 Cross Hyb Matching Probes None
GENEFINDER00000037126 2/11 Cross Hyb Matching Probes None
SNAP00000043526 1/11 Cross Hyb Matching Probes None
GENEFINDER00000043530 1/11 Cross Hyb Matching Probes None
SNAP00000002816 1/11 Cross Hyb Matching Probes None
SNAP00000002817 1/11 Cross Hyb Matching Probes None
GENEFINDER00000002822 1/11 Cross Hyb Matching Probes None
GENEFINDER00000002824 1/11 Cross Hyb Matching Probes None
SNAP00000007051 2/11 Cross Hyb Matching Probes None
SNAP00000007052 1/11 Cross Hyb Matching Probes None
GENEFINDER00000007058 1/11 Cross Hyb Matching Probes None
GENEFINDER00000007063 1/11 Cross Hyb Matching Probes None
SNAP00000011265 1/11 Cross Hyb Matching Probes None
GENEFINDER00000011290 1/11 Cross Hyb Matching Probes None
SNAP00000011428 1/11 Cross Hyb Matching Probes None
GENEFINDER00000011431 1/11 Cross Hyb Matching Probes None
SNAP00000018332 1/11 Cross Hyb Matching Probes None
GENEFINDER00000018334 1/11 Cross Hyb Matching Probes None
SNAP00000020011 1/11 Cross Hyb Matching Probes None
GENEFINDER00000020025 1/11 Cross Hyb Matching Probes None
SNAP00000023008 1/11 Cross Hyb Matching Probes None
SNAP00000023009 2/11 Cross Hyb Matching Probes None
SNAP00000023010 1/11 Cross Hyb Matching Probes None
GENEFINDER00000023016 1/11 Cross Hyb Matching Probes None
GENEFINDER00000023017 2/11 Cross Hyb Matching Probes None
SNAP00000023063 1/11 Cross Hyb Matching Probes None
GENEFINDER00000023069 1/11 Cross Hyb Matching Probes None
SNAP00000035388 1/11 Cross Hyb Matching Probes None
SNAP00000035390 1/11 Cross Hyb Matching Probes None
GENEFINDER00000035395 1/11 Cross Hyb Matching Probes None
GENEFINDER00000035407 1/11 Cross Hyb Matching Probes None
SNAP00000002234 1/11 Cross Hyb Matching Probes None
GENEFINDER00000002246 1/11 Cross Hyb Matching Probes None
SNAP00000008502 1/11 Cross Hyb Matching Probes None
GENEFINDER00000008503 1/11 Cross Hyb Matching Probes None
C09G5.5 1/11 Cross Hyb Matching Probes A 
W05G11.3.1 1/11 Cross Hyb Matching Probes None
W05G11.3.2 1/11 Cross Hyb Matching Probes None
C29E4.1 1/11 Cross Hyb Matching Probes None
W05B2.5 7/11 Cross Hyb Matching Probes A 
Y41C4A.19 2/11 Cross Hyb Matching Probes None
F14F7.1.2 1/11 Cross Hyb Matching Probes A 
F14F7.1.1 1/11 Cross Hyb Matching Probes A 
F14F7.1.3 1/11 Cross Hyb Matching Probes A 
K02D7.3 1/11 Cross Hyb Matching Probes A 
F30B5.1 1/11 Cross Hyb Matching Probes A 
T28C6.4 2/11 Cross Hyb Matching Probes A 
T28C6.6 2/11 Cross Hyb Matching Probes A 
C53B4.5 1/11 Cross Hyb Matching Probes A 
C24F3.6 1/11 Cross Hyb Matching Probes None
C29F4.1.2 2/11 Cross Hyb Matching Probes None
C29F4.1.1 2/11 Cross Hyb Matching Probes None
F52B11.4 2/11 Cross Hyb Matching Probes A 
T15B7.4 1/11 Cross Hyb Matching Probes A 
T15B7.3 1/11 Cross Hyb Matching Probes A 
B0222.7 2/11 Cross Hyb Matching Probes A 
F15H10.2 1/11 Cross Hyb Matching Probes A 
F15H10.1.2 1/11 Cross Hyb Matching Probes A 
F15H10.1.1 1/11 Cross Hyb Matching Probes A 
F57B7.3 1/11 Cross Hyb Matching Probes A 
F23H12.4.2 1/11 Cross Hyb Matching Probes A 
F23H12.4.1 1/11 Cross Hyb Matching Probes A 
F57B1.3 1/11 Cross Hyb Matching Probes A 
F57B1.4.1 1/11 Cross Hyb Matching Probes A 
F57B1.4.3 1/11 Cross Hyb Matching Probes None
F57B1.4.2 2/11 Cross Hyb Matching Probes A 
C50B6.4 1/11 Cross Hyb Matching Probes A 
Y2H9A.3 1/11 Cross Hyb Matching Probes A 
EGAP7.1.1 1/11 Cross Hyb Matching Probes None
EGAP7.1.2 1/11 Cross Hyb Matching Probes None
F14H12.1 1/11 Cross Hyb Matching Probes A 
Genomic Alignment of Consensus/Exemplar Sequence
Assembly Wormbase March 2004
Alignment(s)
Position Identity Coverage Cytoband
chrIII:10986739-10987703(-) 100.0 100.0
chrIII:10982072-10983099(-) 98.8 98.8
chrIII:10984485-10985447(-) 97.49 97.49
Public Domain and Genome References
Gene Title

Gene Symbol col-94
col-92
Ensembl W05B2.6
W05B2.1
Entrez Gene 176528 Entrez gene
259336 Entrez gene
SwissProt Q9U349 EMBL-EBI
Q9XVG3 EMBL-EBI
WormBase CE20144 Wormbase
CE20148 Wormbase
Functional Annotations
Gene Ontology
GO Biological Process (view graph)
ID Description Evidence Links
6817 phosphate transport inferred from electronic annotation QuickGO AmiGO
GO Cellular Component (view graph)
ID Description Evidence Links
5737 cytoplasm inferred from electronic annotation QuickGO AmiGO
GO Molecular Function (view graph)
ID Description Evidence Links
42302 structural constituent of cuticle inferred from electronic annotation QuickGO AmiGO
Protein Similarities
Method ID Description E-Value
blast CAB03475 Hypothetical protein W05B2.1 [Caenorhabditis elegans] ref|NP_499410.1| COLlagen family member (col-94) [Caenorhabditis elegans] 5.0E-45
blast CAB03474 Hypothetical protein W05B2.6 [Caenorhabditis elegans] ref|NP_499408.1| COLlagen family member (col-92) [Caenorhabditis elegans] 2.0E-44
blast CAB63321 Hypothetical protein W05B2.5 [Caenorhabditis elegans] ref|NP_499409.1| COLlagen family member (col-93) [Caenorhabditis elegans] 2.0E-43
Protein Domains
Database ID Description E-Value
Pfam IPR002486 EMBL-EBI Nematode cuticle collagen, N-terminal 4.8E-10
Pfam IPR008160 EMBL-EBI Collagen triple helix repeat 8.6E-8
Pfam IPR008160 EMBL-EBI Collagen triple helix repeat 3.1E-12
Pfam IPR002486 EMBL-EBI Nematode cuticle collagen, N-terminal 4.8E-10
Pfam IPR008160 EMBL-EBI Collagen triple helix repeat 8.6E-8
Pfam IPR008160 EMBL-EBI Collagen triple helix repeat 3.1E-12
Pfam IPR002486 EMBL-EBI Nematode cuticle collagen, N-terminal 8.1E-11
Trans Membrane
ID Number Of Domains Domain Boundaries
NP_499410.1 1 12-34
NP_499408.1 1 12-34
W05B2.6 1 12-34
W05B2.1 1 12-34
SNAP00000036390 1 32-54
GENEFINDER00000036401 1 12-34
SNAP00000036392 1 12-34
GENEFINDER00000036395 1 12-34
Sequence
Target Sequence 
>C. ELEGANS:172197_X_AT
aggaggatcatgctctggatgctgccttccaggagccgctggaccagccggaaccccagg
aaagccaggaagaccaggacgtccaggagcagctggacttccaggaaacccaggacgccc
accagcacagccatgtgagccaatcaccccaccaccatgcaagccatgcccacaaggacc
agctggagccccaggagccccaggaccacaaggagatgccggagcaccaggacaagccgg
acaaggatcaggagccggagccccaggaccagctggaccaaagggagccccaggagcccc
aggaaacccaggacaagccggagccccaggacaaccaggatccgacgctcaatccgagtc
ttctccaggagccccaggacaagccggaccacaaggaccaccaggaccagctggatcccc
aggagcaccaggaggaccaggacaagccggagccccaggaccaaagggaccatcaggagc
cccaggacagccaggagccgacggaaacccaggagccccaggacagccaggacaatctgg
aggtgccggagagaagggaatctgtccaaagtactgcgcc

BLASTn GenBank NR
Probe Info
Probe Sequence(5'-3') Probe X Probe Y Probe Interrogation
Position 		Strandedness
AGGAGGATCATGCTCTGGATGCTGC 289 57 303 Antisense
AAGACCAGGACGTCCAGGAGCAGCT 656 151 372 Antisense
AGCCCCAGGACCACAAGGAGATGCC 355 83 498 Antisense
GGACAAGGATCAGGAGCCGGAGCCC 630 525 541 Antisense
GGACCAGCTGGACCAAAGGGAGCCC 316 523 568 Antisense
CAGGAAACCCAGGACAAGCCGGAGC 82 209 602 Antisense
AGGACCACCAGGACCAGCTGGATCC 32 57 696 Antisense
CCCAGGAGCACCAGGAGGACCAGGA 411 257 720 Antisense
GAGCCCCAGGACCAAAGGGACCATC 628 385 752 Antisense
GCCAGGAGCCGACGGAAACCCAGGA 553 277 792 Antisense
GGGAATCTGTCCAAAGTACTGCGCC 621 493 858 Antisense
Sequence Source Affymetrix Proprietary Database