|
|
Cluster Members Consensus/Exemplar Group Members |
GeneChip Array Information |
|
172062_x_at |
|
C. elegans Genome Array |
|
Nematode |
Probe Design Information |
|
affy.Ce.19952
|
|
Exemplar sequence
|
|
3452400 NCBI
|
|
g3452400 /REP_DB=GenBank Identifier /GB=AF083647.1 /PROTEIN_GB=AAC32858.1 /CHR=X /FEA=Mapped Transcript /DEF=putative potassium channel subunit n2P17m2-2
|
This cluster is supported by a Mapped Transcript. |
Annotation Method Description |
|
This probe set was annotated using the Matching Probes based pipeline to a RefSeq identifier using 1 transcript(s). |
|
This is a grade A annotation. |
|
NM_001029294(11), NM_001029296(11), NM_001029292(11), NM_001029293(11), NM_001029291(11), NM_001029295(10) |
|
|
|
|
|
NM_001029294 NCBI |
Caenorhabditis elegans TWiK family of potassium channels family member (twk-17) (twk-17) mRNA, complete cds. |
11/11 |
None |
NM_001029296 NCBI |
Caenorhabditis elegans TWiK family of potassium channels family member (twk-17) (twk-17) mRNA, complete cds. |
11/11 |
None |
NM_001029292 NCBI |
Caenorhabditis elegans TWiK family of potassium channels family member (twk-17) (twk-17) mRNA, complete cds. |
11/11 |
None |
NM_001029293 NCBI |
Caenorhabditis elegans TWiK family of potassium channels family member (twk-17) (twk-17) mRNA, complete cds. |
11/11 |
None |
NM_001029291 NCBI |
Caenorhabditis elegans TWiK family of potassium channels family member (twk-17) (twk-17) mRNA, complete cds. |
11/11 |
None |
NM_001029295 NCBI |
Caenorhabditis elegans TWiK family of potassium channels family member (twk-17) (twk-17) mRNA, complete cds. |
10/11 |
None |
SNAP00000016789 ENSEMBL |
cdna:SNAP chromosome:CEL140:X:7600307:7603348:-1 |
11/11 |
None |
GENEFINDER00000016791 ENSEMBL |
cdna:GeneFinder chromosome:CEL140:X:7600307:7606584:-1 |
11/11 |
None |
C44E12.3d ENSEMBL |
cdna:known chromosome:CEL140:X:7599778:7606338:-1 gene:C44E12.3 |
11/11 |
A |
C44E12.3e ENSEMBL |
cdna:known chromosome:CEL140:X:7599810:7606338:-1 gene:C44E12.3 |
11/11 |
A |
C44E12.3f ENSEMBL |
cdna:known chromosome:CEL140:X:7600307:7607948:-1 gene:C44E12.3 |
11/11 |
None |
C44E12.3c ENSEMBL |
cdna:known chromosome:CEL140:X:7600307:7606338:-1 gene:C44E12.3 |
11/11 |
A |
C44E12.3a ENSEMBL |
cdna:known chromosome:CEL140:X:7600307:7604350:-1 gene:C44E12.3 |
11/11 |
A |
C44E12.3b ENSEMBL |
cdna:known chromosome:CEL140:X:7600307:7607948:-1 gene:C44E12.3 |
11/11 |
A | |
There are no noteworthy cross hybridizing mRNAs found for this probe set. | |
Genomic Alignment of Consensus/Exemplar Sequence |
|
Wormbase March 2004 |
|
|
|
|
|
chrX:7600305-7606337(-) |
100.0 |
100.0 |
| |
Public Domain and Genome References |
|
C44E12.3
|
Functional Annotations |
|
|
|
|
|
blast |
AAM51532 |
Twik family of potassium channels protein 17, isoform d [Caenorhabditis elegans] ref|NP_001024465.1| TWiK family of potassium channels family member (twk-17) [Caenorhabditis elegans] gb|AAC32862.1| putative potassium channel subunit n2P17m2-1 [Caenorhabditis elegans] |
0.0 |
blast |
AAM51531 |
Twik family of potassium channels protein 17, isoform c [Caenorhabditis elegans] ref|NP_001024464.1| TWiK family of potassium channels family member (twk-17) [Caenorhabditis elegans] gb|AAC32858.1| putative potassium channel subunit n2P17m2-2 [Caenorhabditis elegans] |
0.0 |
blast |
AAP31441 |
Twik family of potassium channels protein 17, isoform e [Caenorhabditis elegans] ref|NP_001024466.1| TWiK family of potassium channels family member (twk-17) [Caenorhabditis elegans] gb|AAC32859.1| putative potassium channel subunit n2P17m2-3 [Caenorhabditis elegans] |
0.0 |
blast |
AAW30673 |
Twik family of potassium channels protein 17, isoform f [Caenorhabditis elegans] ref|NP_001024467.1| TWiK family of potassium channels family member (twk-17) [Caenorhabditis elegans] gb|AAC32854.1| putative potassium channel subunit n2P17m1-2 [Caenorhabditis elegans] |
0.0 |
blast |
AAM51530 |
Twik family of potassium channels protein 17, isoform b [Caenorhabditis elegans] ref|NP_001024463.1| TWiK family of potassium channels family member (twk-17) [Caenorhabditis elegans] gb|AAC32855.1| putative potassium channel subunit n2P17m1-1 [Caenorhabditis elegans] |
0.0 |
blast |
AAM51529 |
Twik family of potassium channels protein 17, isoform a [Caenorhabditis elegans] ref|NP_001024462.1| TWiK family of potassium channels family member (twk-17) [Caenorhabditis elegans] |
0.0 | |
|
NP_001024465.1 |
6 |
142-164,243-265,275-297,365-387,392-414,421-440 |
NP_001024467.1 |
6 |
78-100,179-201,211-233,301-323,328-350,357-376 |
NP_001024463.1 |
6 |
78-100,179-201,211-233,301-323,328-350,357-376 |
NP_001024464.1 |
6 |
142-164,243-265,275-297,365-387,392-414,421-440 |
NP_001024462.1 |
6 |
85-107,186-208,218-240,308-330,335-357,364-383 |
NP_001024466.1 |
6 |
142-164,243-265,275-297,365-387,392-414,421-440 |
C44E12.3d |
6 |
142-164,243-265,275-297,365-387,392-414,421-440 |
C44E12.3e |
6 |
142-164,243-265,275-297,365-387,392-414,421-440 |
C44E12.3f |
6 |
78-100,179-201,211-233,301-323,328-350,357-376 |
C44E12.3c |
6 |
142-164,243-265,275-297,365-387,392-414,421-440 |
C44E12.3a |
6 |
85-107,186-208,218-240,308-330,335-357,364-383 |
C44E12.3b |
6 |
78-100,179-201,211-233,301-323,328-350,357-376 |
SNAP00000016789 |
5 |
88-110,125-147,176-198,203-225,232-251 |
GENEFINDER00000016791 |
6 |
224-246,325-347,357-379,447-469,474-496,595-617 | |
Sequence |
|
>C. ELEGANS:172062_X_AT
cgtatggtcattcattcacggcgtcttcttctcattcaataccatcacaacaattggatt
gggaaatattcgagttcagcagcactactaccttgcactcgcggtatcttatgtaattat
cggtcttgctgtcatcactgcatcactggatctctgttcctctacactgaaacgaacatt
taccaaacttcactactttggaagaaagattcgtggtgctcgacgtggttttgcaaatat
gagcgatgacatccgagaagcaatgcgaataattgctgcgttgaaaaagacaaggccatc
gaaagatcgaataactttggaagacttgaagcggttccttgaagttcaggagcatctgct
ccgacaaccatatgtcccttataacgttcacctccttcgatggatcgaagacaatgttgg
tccacagatgaaaaatgagttttccctagcagaacaatatgcacaatacatggatgatgt
ctctggaggtaaaacaccaatgtccccatc
BLASTn GenBank NR |
|
|
|
|
|
|
CGTATGGTCATTCATTCACGGCGTC |
278 |
245 |
1185 |
Antisense |
TCTTCTTCTCATTCAATACCATCAC |
395 |
617 |
1208 |
Antisense |
ATTCGAGTTCAGCAGCACTACTACC |
238 |
7 |
1252 |
Antisense |
CTTGCACTCGCGGTATCTTATGTAA |
577 |
217 |
1276 |
Antisense |
TAATTATCGGTCTTGCTGTCATCAC |
252 |
635 |
1298 |
Antisense |
ATCACTGCATCACTGGATCTCTGTT |
97 |
29 |
1318 |
Antisense |
TCTCTGTTCCTCTACACTGAAACGA |
601 |
611 |
1335 |
Antisense |
AAGATTCGTGGTGCTCGACGTGGTT |
337 |
155 |
1390 |
Antisense |
GCATCTGCTCCGACAACCATATGTC |
643 |
309 |
1536 |
Antisense |
CATATGTCCCTTATAACGTTCACCT |
143 |
215 |
1553 |
Antisense |
GAGGTAAAACACCAATGTCCCCATC |
486 |
401 |
1670 |
Antisense | |
|
GenBank | |