|
|
Cluster Members Consensus/Exemplar Group Members |
GeneChip Array Information |
|
172047_x_at |
|
C. elegans Genome Array |
|
Nematode |
Probe Design Information |
|
affy.Ce.19802
|
|
Exemplar sequence
|
|
6681681 NCBI
|
|
g6681681 /REP_DB=GenBank Identifier /GB=AB017107.1 /PROTEIN_GB=BAA88838.1 /CHR=3 /FEA=Mapped Transcript /DEF=Kinesin associated protein kap-1
|
This cluster is supported by a Mapped Transcript. |
Annotation Method Description |
|
This probe set was annotated using the Matching Probes based pipeline to a RefSeq identifier using 1 transcript(s). |
|
This is a grade A annotation. |
|
NM_001027445(11), NM_001026076(11), NM_001026075(11) |
|
|
|
|
|
NM_001027445 NCBI |
Caenorhabditis elegans yeast Glc Seven-like Phosphatases family member (gsp-2) (gsp-2) mRNA, complete cds. |
11/11 |
None |
NM_001026076 NCBI |
Caenorhabditis elegans Kinesin-Associated Protein family member (kap-1) (kap-1) mRNA, complete cds. |
11/11 |
None |
NM_001026075 NCBI |
Caenorhabditis elegans Kinesin-Associated Protein family member (kap-1) (kap-1) mRNA, complete cds. |
11/11 |
None |
GENEFINDER00000010823 ENSEMBL |
cdna:GeneFinder chromosome:CEL140:III:7338923:7343495:1 |
10/11 |
None |
SNAP00000010808 ENSEMBL |
cdna:SNAP chromosome:CEL140:III:7339592:7343495:1 |
10/11 |
None |
F56C9.1.1 ENSEMBL |
cdna:known chromosome:CEL140:III:7336508:7343568:1 gene:F56C9.1 |
11/11 |
None |
F08F8.3a ENSEMBL |
cdna:known chromosome:CEL140:III:7338923:7343548:1 gene:F08F8.3 |
11/11 |
None |
F08F8.3b ENSEMBL |
cdna:known chromosome:CEL140:III:7338923:7343495:1 gene:F08F8.3 |
10/11 |
None | |
There are no noteworthy cross hybridizing mRNAs found for this probe set. | |
Genomic Alignment of Consensus/Exemplar Sequence |
|
Wormbase March 2004 |
|
|
|
|
|
chrIII:7338920-7343566(+) |
100.0 |
100.0 |
| |
Public Domain and Genome References |
|
|
|
gsp-2
|
|
F56C9.1 F08F8.3
|
|
3564807 Entrez gene
|
|
P48727 EMBL-EBI
|
|
CE01319 Wormbase
|
Functional Annotations |
|
|
|
|
ATGENOME1:20314_S_AT |
serine/threonine protein phosphatase PP1 isozyme 6 (PP1BG) (TOPP6) |
at |
ATH1-121501:254923_AT |
serine/threonine protein phosphatase PP1 isozyme 6 (PP1BG) (TOPP6) |
at |
CANINE:1582493_AT |
protein phosphatase 1, catalytic subunit, alpha isoform |
cfa |
CANINE_2:CFAAFFX.18039.1.S1_S_AT |
protein phosphatase 1, catalytic subunit, alpha isoform |
cfa |
CANINE_2:CFA.3471.1.S1_AT |
protein phosphatase 1, catalytic subunit, alpha isoform |
cfa |
DROSOPHILA_2:1625806_AT |
Protein phosphatase 1 at 96A |
dm |
DROSGENOME1:143310_AT |
Protein phosphatase 1 at 96A |
dm |
HG-U133_PLUS_2:200846_S_AT |
protein phosphatase 1, catalytic subunit, alpha isoform |
hs |
HG-U133A:200846_S_AT |
protein phosphatase 1, catalytic subunit, alpha isoform |
hs |
HG-FOCUS:200846_S_AT |
protein phosphatase 1, catalytic subunit, alpha isoform |
hs |
HG-U133A_2:200846_S_AT |
protein phosphatase 1, catalytic subunit, alpha isoform |
hs |
U133_X3P:G4506002_3P_A_AT |
protein phosphatase 1, catalytic subunit, alpha isoform |
hs |
HG-U95AV2:32157_AT |
protein phosphatase 1, catalytic subunit, alpha isoform |
hs |
HG-U95D:74577_S_AT |
protein phosphatase 1, catalytic subunit, alpha isoform |
hs |
MOUSE430_2:1460165_AT |
protein phosphatase 1, catalytic subunit, alpha isoform |
mm |
MOE430A:1460165_AT |
protein phosphatase 1, catalytic subunit, alpha isoform |
mm |
MOUSE430A_2:1460165_AT |
protein phosphatase 1, catalytic subunit, alpha isoform |
mm |
MU11KSUBA:AA218341_S_AT |
protein phosphatase 1, catalytic subunit, alpha isoform |
mm |
MU11KSUBB:MSA.3454.0_F_AT |
protein phosphatase 1, catalytic subunit, alpha isoform |
mm |
MU11KSUBB:MSA.10308.0_F_AT |
protein phosphatase 1, catalytic subunit, alpha isoform |
mm |
MG-U74CV2:134841_AT |
protein phosphatase 1, catalytic subunit, alpha isoform |
mm |
MG-U74BV2:165128_R_AT |
protein phosphatase 1, catalytic subunit, alpha isoform |
mm |
MU11KSUBB:MSA.29209.0_S_AT |
Protein phosphatase 1, catalytic subunit, alpha isoform, mRNA (cDNA clone MGC:25955 IMAGE:4239005) |
mm |
MU19KSUBB:TC31824_AT |
Protein phosphatase 1, catalytic subunit, alpha isoform, mRNA (cDNA clone MGC:25955 IMAGE:4239005) |
mm |
MU19KSUBC:TC36035_AT |
Protein phosphatase 1, catalytic subunit, alpha isoform, mRNA (cDNA clone MGC:25955 IMAGE:4239005) |
mm |
MU19KSUBC:TC39781_AT |
Protein phosphatase 1, catalytic subunit, alpha isoform, mRNA (cDNA clone MGC:25955 IMAGE:4239005) |
mm |
RG-U34A:S78215_S_AT |
protein phosphatase 1, catalytic subunit, alpha isoform |
rn |
RG-U34C:RC_AA817897_S_AT |
protein phosphatase 1, catalytic subunit, alpha isoform |
rn |
RAE230A:1386863_AT |
protein phosphatase 1, catalytic subunit, alpha isoform |
rn |
RAT230_2:1386863_AT |
protein phosphatase 1, catalytic subunit, alpha isoform |
rn |
YEAST_2:1777225_AT |
Catalytic subunit of type 1 serine/threonine protein phosphatase, involved in many processes including glycogen metabolism, sporulation, and mitosis; interacts with multiple regulatory subunits; predominantly isolated with Sds22p |
Sc | |
|
|
|
|
|
16787 |
hydrolase activity |
inferred from electronic annotation |
QuickGO AmiGO | |
|
|
|
|
|
blast |
AAK18957 |
Yeast glc seven-like phosphatases protein 2 [Caenorhabditis elegans] ref|NP_001022616.1| yeast Glc Seven-like Phosphatases family member (gsp-2) [Caenorhabditis elegans] sp|P48727|YMEX_CAEEL Putative serine/threonine protein phosphatase F56C9.1 in chromosome III |
0.0 |
blast |
CAE57617 |
Hypothetical protein CBG00598 [Caenorhabditis briggsae] |
0.0 |
blast |
AAK68307 |
Kinesin-associated protein protein 1, isoform b [Caenorhabditis elegans] ref|NP_001021247.1| Kinesin-Associated Protein family member (kap-1) [Caenorhabditis elegans] dbj|BAA88838.1| Kinesin associated protein kap-1 [Caenorhabditis elegans] |
0.0 |
blast |
AAM22059 |
Kinesin-associated protein protein 1, isoform a [Caenorhabditis elegans] ref|NP_001021246.1| Kinesin-Associated Protein family member (kap-1) [Caenorhabditis elegans] |
0.0 |
blast |
AAF99086 |
KAP [Caenorhabditis elegans] |
0.0 | |
|
|
|
|
|
Pfam |
IPR008658 EMBL-EBI |
Kinesin-associated |
1.0E-126 |
Pfam |
IPR008658 EMBL-EBI |
Kinesin-associated |
1.0E-126 |
Pfam |
IPR008658 EMBL-EBI |
Kinesin-associated |
1.0E-126 |
Pfam |
IPR008658 EMBL-EBI |
Kinesin-associated |
1.0E-126 |
Pfam |
IPR008658 EMBL-EBI |
Kinesin-associated |
1.0E-126 |
Pfam |
IPR008658 EMBL-EBI |
Kinesin-associated |
1.0E-126 |
Pfam |
IPR008658 EMBL-EBI |
Kinesin-associated |
2.1E-122 |
Pfam |
IPR008658 EMBL-EBI |
Kinesin-associated |
1.0E-126 |
Pfam |
IPR004843 EMBL-EBI |
Metallo-phosphoesterase |
2.7E-44 | |
Sequence |
|
>C. ELEGANS:172047_X_AT
acataaaacctctccaactacaaattgtaattgcttgtggaacaatggctaggcaattgg
atgcagctaggttattggctcctttgattgatacatttgtgcagttattacaatcatgcc
aaattgatgatgagtttgttgtgcaacttctctacgttttcttgcaatttttaaagcaca
aggaactatctgctcgcctgatgactcaagattcagctctcggagcccatatgatcgatt
tgatgcacgatgcaaacgcagtggttcgagaagtttgcgataatgcccttttgataatgg
gtgaacattcaaaagaatgggcaaaacggatagctggagagagattcaaatggcacaatg
cacaatggttggagatggttgagcgagacgacagcgaattcgtagattacgatgatgaag
attttggagctgatctcaaatttgatcactatgatgatggatttgatatgaatgagcccc
ttttttaactt
BLASTn GenBank NR |
|
|
|
|
|
|
ACATAAAACCTCTCCAACTACAAAT |
564 |
69 |
1565 |
Antisense |
GCAGCTAGGTTATTGGCTCCTTTGA |
306 |
313 |
1627 |
Antisense |
GAGTTTGTTGTGCAACTTCTCTACG |
251 |
399 |
1696 |
Antisense |
CTTCTCTACGTTTTCTTGCAATTTT |
391 |
221 |
1711 |
Antisense |
GCACAAGGAACTATCTGCTCGCCTG |
601 |
317 |
1740 |
Antisense |
ATCTGCTCGCCTGATGACTCAAGAT |
369 |
33 |
1752 |
Antisense |
GACTCAAGATTCAGCTCTCGGAGCC |
522 |
373 |
1767 |
Antisense |
AGCTCTCGGAGCCCATATGATCGAT |
89 |
81 |
1779 |
Antisense |
GTTTGCGATAATGCCCTTTTGATAA |
177 |
451 |
1837 |
Antisense |
GGTTGAGCGAGACGACAGCGAATTC |
380 |
507 |
1941 |
Antisense |
TATGAATGAGCCCCTTTTTTAACTT |
695 |
653 |
2031 |
Antisense | |
|
GenBank | |