|
|
Cluster Members Consensus/Exemplar |
GeneChip Array Information |
|
171984_at |
|
C. elegans Genome Array |
|
Nematode |
Probe Design Information |
|
affy.Ce.27680
|
|
Exemplar sequence
|
|
AV179943 NCBI
|
|
AV179943_rc /REP_DB=TREMBL Accession /GB=AV179943 /FEA=Transcript Cluster /DEF=Caenorhabditis elegans cDNA clone:yk600c2 : 3prime end, single read.
|
This cluster is supported by a Transcript Cluster. |
Annotation Method Description |
|
This probe set was annotated using the Matching Probes based pipeline to a RefSeq identifier using 1 transcript(s). |
|
This is a grade A annotation. |
|
NM_074158(10) |
|
|
|
|
|
NM_074158 NCBI |
Caenorhabditis elegans Vacuolar H ATPase family member (vha-13) (vha-13) mRNA, complete cds. |
10/11 |
None |
Y49A3A.2.3 ENSEMBL |
cdna:known chromosome:CEL140:V:14353501:14357009:1 gene:Y49A3A.2 |
10/11 |
None |
Y49A3A.2.4 ENSEMBL |
cdna:known chromosome:CEL140:V:14354297:14357009:1 gene:Y49A3A.2 |
10/11 |
None |
Y49A3A.2.2 ENSEMBL |
cdna:known chromosome:CEL140:V:14354297:14357009:1 gene:Y49A3A.2 |
10/11 |
A |
Y49A3A.2.1 ENSEMBL |
cdna:known chromosome:CEL140:V:14354299:14357009:1 gene:Y49A3A.2 |
10/11 |
A | |
There are no noteworthy cross hybridizing mRNAs found for this probe set. | |
Genomic Alignment of Consensus/Exemplar Sequence |
|
Wormbase March 2004 |
|
|
|
|
|
chrV:14356662-14356944(+) |
89.58 |
89.58 |
| |
Public Domain and Genome References |
|
ATP synthase alpha and beta subunits ; ATP synthase ab C terminal
|
|
vha-13
|
|
Y49A3A.2
|
|
3564970 Entrez gene
|
|
Q9XW92 EMBL-EBI
|
|
CE22210 Wormbase
|
Functional Annotations |
|
|
|
|
ATH1-121501:264302_AT |
vacuolar ATP synthase catalytic subunit A / V-ATPase A subunit / vacuolar proton pump alpha subunit / V-ATPase 69 kDa subunit |
at |
ATGENOME1:12775_S_AT |
vacuolar ATP synthase catalytic subunit A / V-ATPase A subunit / vacuolar proton pump alpha subunit / V-ATPase 69 kDa subunit |
at |
CANINE_2:CFAAFFX.16764.1.S1_AT |
similar to ATPase, H+ transporting, lysosomal 70kD, V1 subunit A, isoform 1 |
cfa |
DROSOPHILA_2:1634961_S_AT |
|
dm |
DROSGENOME1:146305_AT |
|
dm |
CHICKEN:GGA.1712.1.S1_A_AT |
ATPase, H+ transporting, lysosomal 70kDa, V1 subunit A |
gga |
CHICKEN:GGA.1712.2.S1_A_AT |
ATPase, H+ transporting, lysosomal 70kDa, V1 subunit A |
gga |
HG-U133_PLUS_2:201972_AT |
ATPase, H+ transporting, lysosomal 70kDa, V1 subunit A |
hs |
HG-U133A_2:201972_AT |
ATPase, H+ transporting, lysosomal 70kDa, V1 subunit A |
hs |
HG-U133A:201972_AT |
ATPase, H+ transporting, lysosomal 70kDa, V1 subunit A |
hs |
HG-FOCUS:201972_AT |
ATPase, H+ transporting, lysosomal 70kDa, V1 subunit A |
hs |
HG-U133_PLUS_2:201971_S_AT |
ATPase, H+ transporting, lysosomal 70kDa, V1 subunit A |
hs |
HG-U133A:201971_S_AT |
ATPase, H+ transporting, lysosomal 70kDa, V1 subunit A |
hs |
HG-U133A_2:201971_S_AT |
ATPase, H+ transporting, lysosomal 70kDa, V1 subunit A |
hs |
HU35KSUBA:RC_AA228122_AT |
ATPase, H+ transporting, lysosomal 70kDa, V1 subunit A |
hs |
HUGENEFL:L09235_AT |
ATPase, H+ transporting, lysosomal 70kDa, V1 subunit A |
hs |
U133_X3P:G6523820_3P_AT |
ATPase, H+ transporting, lysosomal 70kDa, V1 subunit A |
hs |
U133_X3P:G4502304_3P_A_AT |
ATPase, H+ transporting, lysosomal 70kDa, V1 subunit A |
hs |
HG-U95AV2:34889_AT |
ATPase, H+ transporting, lysosomal 70kDa, V1 subunit A |
hs |
HG-U95AV2:34890_AT |
ATPase, H+ transporting, lysosomal 70kDa, V1 subunit A |
hs |
HG-U95D:75635_R_AT |
ATPase, H+ transporting, lysosomal 70kDa, V1 subunit A |
hs |
MOUSE430_2:1422508_AT |
ATPase, H+ transporting, V1 subunit A1 |
mm |
MOUSE430A_2:1422508_AT |
ATPase, H+ transporting, V1 subunit A1 |
mm |
MOE430A:1422508_AT |
ATPase, H+ transporting, V1 subunit A1 |
mm |
MOUSE430_2:1450634_AT |
ATPase, H+ transporting, V1 subunit A1 |
mm |
MOE430A:1450634_AT |
ATPase, H+ transporting, V1 subunit A1 |
mm |
MOUSE430A_2:1450634_AT |
ATPase, H+ transporting, V1 subunit A1 |
mm |
MU11KSUBB:MSA.14012.0_F_AT |
ATPase, H+ transporting, V1 subunit A1 |
mm |
MU11KSUBB:MSA.1867.0_S_AT |
ATPase, H+ transporting, V1 subunit A1 |
mm |
MOE430B:1445916_AT |
ATPase, H+ transporting, V1 subunit A1, mRNA (cDNA clone MGC:6531 IMAGE:2651677) |
mm |
MOUSE430_2:1445916_AT |
ATPase, H+ transporting, V1 subunit A1, mRNA (cDNA clone MGC:6531 IMAGE:2651677) |
mm |
MG-U74AV2:95746_AT |
ATPase, H+ transporting, V1 subunit A1, mRNA (cDNA clone MGC:6531 IMAGE:2651677) |
mm |
MU19KSUBB:TC30326_AT |
ATPase, H+ transporting, V1 subunit A1, mRNA (cDNA clone MGC:6531 IMAGE:2651677) |
mm |
MU19KSUBB:TC30326_G_AT |
ATPase, H+ transporting, V1 subunit A1, mRNA (cDNA clone MGC:6531 IMAGE:2651677) |
mm |
MU19KSUBB:TC30327_AT |
ATPase, H+ transporting, V1 subunit A1, mRNA (cDNA clone MGC:6531 IMAGE:2651677) |
mm |
RG-U34C:RC_AI071788_AT |
ATPase, H+ transporting, V1 subunit A, isoform 1 (predicted) |
rn |
RAE230A:1382048_AT |
ATPase, H+ transporting, V1 subunit A, isoform 1 (predicted) |
rn |
RAT230_2:1382048_AT |
ATPase, H+ transporting, V1 subunit A, isoform 1 (predicted) |
rn |
RAE230A:1374431_AT |
ATPase, H+ transporting, V1 subunit A, isoform 1 (predicted) |
rn |
RAT230_2:1374431_AT |
ATPase, H+ transporting, V1 subunit A, isoform 1 (predicted) |
rn |
RG-U34A:RC_AA892006_AT |
ATPase, H+ transporting, V1 subunit A, isoform 1 (predicted) |
rn |
RG-U34A:RC_AA893217_AT |
ATPase, H+ transporting, V1 subunit A, isoform 1 (predicted) |
rn | |
|
|
|
|
|
6754 |
ATP biosynthesis |
inferred from electronic annotation |
QuickGO AmiGO |
15986 |
ATP synthesis coupled proton transport |
inferred from electronic annotation |
QuickGO AmiGO |
|
|
|
|
16469 |
proton-transporting two-sector ATPase complex |
inferred from electronic annotation |
QuickGO AmiGO |
|
|
|
|
5524 |
ATP binding |
inferred from electronic annotation |
QuickGO AmiGO |
46933 |
hydrogen-transporting ATP synthase activity, rotational mechanism |
inferred from electronic annotation |
QuickGO AmiGO |
46961 |
hydrogen-transporting ATPase activity, rotational mechanism |
inferred from electronic annotation |
QuickGO AmiGO | |
|
|
|
|
|
blast |
CAA22076 |
Hypothetical protein Y49A3A.2 [Caenorhabditis elegans] ref|NP_506559.1| Vacuolar H ATPase family member (vha-13) [Caenorhabditis elegans] |
0.0 |
blast |
CAE60915 |
Hypothetical protein CBG04632 [Caenorhabditis briggsae] |
0.0 |
blast |
P38607 |
Vacuolar ATP synthase catalytic subunit A, osteoclast isoform (V-ATPase A subunit 2) (Vacuolar proton pump alpha subunit 2) (V-ATPase 69 kDa subunit 2) (Isoform HO68) gb|AAA35578.1| ATPase |
0.0 | |
|
|
|
|
|
Pfam |
IPR004100 EMBL-EBI |
H+-transporting two-sector ATPase, alpha/beta subunit, N-terminal |
2.0E-22 |
Pfam |
IPR000194 EMBL-EBI |
H+-transporting two-sector ATPase, alpha/beta subunit, central region |
1.0E-87 |
Pfam |
IPR000793 EMBL-EBI |
H+-transporting two-sector ATPase, alpha/beta subunit, C-terminal |
1.3E-52 | |
Sequence |
|
>C. ELEGANS:171984_AT
tgtaataactttatcctctttaaagtgtttgattgatttgacattccaaatttcagatat
ttattgcaccnnnnnnctcttttgtagatttctaaacttcaanaaattccaaccacacac
aatgtatctggtcgccttacaactcccgttttaaacaacaatttattgttgtttaatcaa
tnnnnnnnntattcttcttgttgaatagactactttacttgtgccctt
BLASTn GenBank NR |
|
|
|
|
|
|
TGTAATAACTTTATCCTCTTTAAAG |
215 |
559 |
29 |
Antisense |
TTATCCTCTTTAAAGTGTTTGATTG |
376 |
681 |
39 |
Antisense |
GTGTTTGATTGATTTGACATTCCAA |
636 |
485 |
53 |
Antisense |
TTGACATTCCAAATTTCAGATATTT |
97 |
703 |
66 |
Antisense |
CCAAATTTCAGATATTTATTGCACC |
191 |
275 |
74 |
Antisense |
CTCTTTTGTAGATTTCTAAACTTCA |
49 |
221 |
105 |
Antisense |
AAATTCCAACCACACACAATGTATC |
574 |
115 |
132 |
Antisense |
CACACACAATGTATCTGGTCGCCTT |
195 |
195 |
142 |
Antisense |
CAATGTATCTGGTCGCCTTACAACT |
1 |
183 |
148 |
Antisense |
TTCTTCTTGTTGAATAGACTACTTT |
235 |
689 |
220 |
Antisense |
AATAGACTACTTTACTTGTGCCCTT |
188 |
173 |
232 |
Antisense | |
|
Affymetrix Proprietary Database | |