|
|
Cluster Members Consensus/Exemplar Group Members |
GeneChip Array Information |
|
171944_x_at |
|
C. elegans Genome Array |
|
Nematode |
Probe Design Information |
|
affy.Ce.27699
|
|
Exemplar sequence
|
|
AV184292 NCBI
|
|
AV184292_rc /REP_DB=TREMBL Accession /GB=AV184292 /FEA=Transcript Cluster /DEF=Caenorhabditis elegans cDNA clone:yk662e3 : 3prime end, single read.
|
This cluster is supported by a Transcript Cluster. |
Annotation Method Description |
|
This probe set was annotated using the Genome Target Overlap based pipeline to a RefSeq identifier using 1 transcript(s). |
|
This is a grade B annotation. |
|
NM_001028999, NM_001028998, NM_001029003, NM_001029001, NM_001029002 |
|
|
|
|
|
T28F12.2b ENSEMBL |
cdna:known chromosome:CEL140:V:4499290:4511257:1 gene:T28F12.2 |
|
A |
NM_001029002 NCBI |
Caenorhabditis elegans UNCoordinated family member (unc-62) (unc-62) mRNA, complete cds. |
|
None |
NM_001029001 NCBI |
Caenorhabditis elegans UNCoordinated family member (unc-62) (unc-62) mRNA, complete cds. |
|
None |
NM_001029003 NCBI |
Caenorhabditis elegans UNCoordinated family member (unc-62) (unc-62) mRNA, complete cds. |
|
None |
NM_001028998 NCBI |
Caenorhabditis elegans UNCoordinated family member (unc-62) (unc-62) mRNA, complete cds. |
|
None |
T28F12.2a.1 ENSEMBL |
cdna:known chromosome:CEL140:V:4497277:4511257:1 gene:T28F12.2 |
|
None |
T28F12.2f ENSEMBL |
cdna:known chromosome:CEL140:V:4497277:4511257:1 gene:T28F12.2 |
|
A |
T28F12.2a.2 ENSEMBL |
cdna:known chromosome:CEL140:V:4497276:4511235:1 gene:T28F12.2 |
|
None |
NM_001028999 NCBI |
Caenorhabditis elegans UNCoordinated family member (unc-62) (unc-62) mRNA, complete cds. |
|
None |
T28F12.2e ENSEMBL |
cdna:known chromosome:CEL140:V:4499144:4511257:1 gene:T28F12.2 |
|
A | |
There are no noteworthy cross hybridizing mRNAs found for this probe set. | |
Genomic Alignment of Consensus/Exemplar Sequence |
|
Wormbase March 2004 |
|
|
|
|
|
chrV:4510875-4511119(+) |
60.62 |
60.62 |
| |
Public Domain and Genome References |
|
T28F12.2
|
Functional Annotations |
|
|
|
|
|
blast |
AAO61421 |
Uncoordinated protein 62, isoform f [Caenorhabditis elegans] ref|NP_001024174.1| UNCoordinated family member (unc-62) [Caenorhabditis elegans] gb|AAL65142.1| UNC-62 splice variant 1a-7a [Caenorhabditis elegans] |
0.0 |
blast |
AAF39974 |
Uncoordinated protein 62, isoform a [Caenorhabditis elegans] ref|NP_001024169.1| UNCoordinated family member (unc-62) [Caenorhabditis elegans] gb|AAL65143.1| UNC-62 splice variant 1a-7b [Caenorhabditis elegans] |
0.0 |
blast |
AAO61420 |
Uncoordinated protein 62, isoform e [Caenorhabditis elegans] ref|NP_001024173.1| UNCoordinated family member (unc-62) [Caenorhabditis elegans] gb|AAL65144.1| UNC-62 splice variant 1b-7a [Caenorhabditis elegans] |
0.0 |
blast |
AAF39975 |
Uncoordinated protein 62, isoform b [Caenorhabditis elegans] ref|NP_001024170.1| UNCoordinated family member (unc-62) [Caenorhabditis elegans] gb|AAL65145.1| UNC-62 splice variant 1b-7b [Caenorhabditis elegans] |
0.0 | |
|
|
|
|
|
scop |
a.4.1.Homeodomain |
All alpha proteins; DNA/RNA-binding 3-helical bundle; Homeodomain-like; Homeodomain |
9.99999999819959E-24 |
scop |
a.4.1.Homeodomain |
All alpha proteins; DNA/RNA-binding 3-helical bundle; Homeodomain-like; Homeodomain |
5.00000009770741E-26 |
scop |
a.4.1.Homeodomain |
All alpha proteins; DNA/RNA-binding 3-helical bundle; Homeodomain-like; Homeodomain |
3.99999995490641E-26 |
Pfam |
IPR001356 EMBL-EBI |
Homeobox |
4.0E-4 |
Pfam |
IPR001356 EMBL-EBI |
Homeobox |
4.0E-4 |
Pfam |
IPR001356 EMBL-EBI |
Homeobox |
4.0E-4 |
Pfam |
IPR001356 EMBL-EBI |
Homeobox |
4.0E-4 | |
Sequence |
|
>C. ELEGANS:171944_X_AT
gtgaccacagggttaataccacacattcaattgctctccacgatgtaatannnnnngacg
naaaatttgnaaagtgagaaactgaaactaattgattaattgccagttcatatcatatgt
atgttcttattctcctcctccagttctcctcatgtttggaactcannnnnctaatattca
ccagtctcttctctcacaaaagacc
BLASTn GenBank NR |
|
|
|
|
|
|
GTGACCACAGGGTTAATACCACACA |
650 |
473 |
81 |
Antisense |
ATACCACACATTCAATTGCTCTCCA |
422 |
23 |
96 |
Antisense |
ATTCAATTGCTCTCCACGATGTAAT |
641 |
11 |
105 |
Antisense |
GTGAGAAACTGAAACTAATTGATTA |
640 |
239 |
154 |
Antisense |
ATTAATTGCCAGTTCATATCATATG |
186 |
13 |
175 |
Antisense |
AATTGCCAGTTCATATCATATGTAT |
99 |
179 |
178 |
Antisense |
CATATGTATGTTCTTATTCTCCTCC |
206 |
215 |
194 |
Antisense |
CTCCAGTTCTCCTCATGTTTGGAAC |
668 |
235 |
218 |
Antisense |
CAGTTCTCCTCATGTTTGGAACTCA |
606 |
205 |
221 |
Antisense |
ACCAGTCTCTTCTCTCACAAAAGAC |
683 |
85 |
260 |
Antisense |
CCAGTCTCTTCTCTCACAAAAGACC |
162 |
273 |
261 |
Antisense | |
|
Affymetrix Proprietary Database |