|
|
Cluster Members Consensus/Exemplar Group Members |
GeneChip Array Information |
|
171924_x_at |
|
C. elegans Genome Array |
|
Nematode |
Probe Design Information |
|
affy.Ce.27726
|
|
Exemplar sequence
|
|
CEK119D9R NCBI
|
|
CEK119D9R_rc /REP_DB=TREMBL Accession /GB=D66615 /FEA=Transcript Cluster /DEF=C.elegans cDNA clone yk119d9 : 3prime end, single read.
|
This cluster is supported by a Transcript Cluster. |
Annotation Method Description |
|
This probe set was annotated using the Matching Probes based pipeline to a RefSeq,GenBank identifier using 1 transcript(s). |
|
This is a grade A annotation. |
|
NM_001025923(10), NM_001025922(10), U04711(10) |
|
|
|
|
|
NM_001025923 NCBI |
Caenorhabditis elegans UNCoordinated family member (unc-87) (unc-87) mRNA, complete cds. |
10/11 |
None |
NM_001025922 NCBI |
Caenorhabditis elegans UNCoordinated family member (unc-87) (unc-87) mRNA, complete cds. |
10/11 |
None |
U04711 NCBI |
Caenorhabditis elegans N2 (unc-87) mRNA, complete cds. |
10/11 |
A |
F08B6.4c.3 ENSEMBL |
cdna:known chromosome:CEL140:I:6769362:6775931:-1 gene:F08B6.4 |
10/11 |
A |
F08B6.4c.2 ENSEMBL |
cdna:known chromosome:CEL140:I:6769362:6773745:-1 gene:F08B6.4 |
10/11 |
A |
F08B6.4c.1 ENSEMBL |
cdna:known chromosome:CEL140:I:6769362:6773846:-1 gene:F08B6.4 |
10/11 |
A |
F08B6.4b.1 ENSEMBL |
cdna:known chromosome:CEL140:I:6769701:6775931:-1 gene:F08B6.4 |
10/11 |
None | |
NM_001025921 |
6/11 |
Cross Hyb Matching Probes |
None |
SNAP00000014331 |
6/11 |
Cross Hyb Matching Probes |
None |
GENEFINDER00000014336 |
3/11 |
Cross Hyb Matching Probes |
None |
GENEFINDER00000014337 |
2/11 |
Cross Hyb Matching Probes |
None |
F08B6.4a |
6/11 |
Cross Hyb Matching Probes |
A |
F08B6.4b.2 |
6/11 |
Cross Hyb Matching Probes |
None | |
|
Genomic Alignment of Consensus/Exemplar Sequence |
|
Wormbase March 2004 |
|
|
|
|
|
chrI:6769642-6769939(-) |
73.67 |
73.67 |
| |
Public Domain and Genome References |
|
F08B6.4
|
Functional Annotations |
|
|
|
|
|
blast |
AAT68897 |
Uncoordinated protein 87, isoform c [Caenorhabditis elegans] ref|NP_001021094.1| UNCoordinated family member (unc-87) [Caenorhabditis elegans] |
0.0 |
blast |
AAC78234 |
Uncoordinated protein 87, isoform a [Caenorhabditis elegans] ref|NP_001021092.1| UNCoordinated family member (unc-87) [Caenorhabditis elegans] pir||T33851 thin filament-associated protein UNC-87, long form - Caenorhabditis elegans gb|AAA81902.1| one of two alternatively spliced products |
0.0 |
blast |
P37806 |
Uncoordinated protein 87 (Protein unc-87) |
0.0 |
blast |
AAK68303 |
Uncoordinated protein 87, isoform b [Caenorhabditis elegans] ref|NP_001021093.1| UNCoordinated family member (unc-87) [Caenorhabditis elegans] gb|AAA81901.1| uses the first of two potential start codons; second of two alternatively spliced products gb|AAA81899.1| uses first of two potential start sites |
0.0 | |
|
|
|
|
|
Pfam |
IPR000557 EMBL-EBI |
Calponin repeat |
1.4E-4 |
Pfam |
IPR000557 EMBL-EBI |
Calponin repeat |
2.3E-8 |
Pfam |
IPR000557 EMBL-EBI |
Calponin repeat |
4.2E-8 |
Pfam |
IPR000557 EMBL-EBI |
Calponin repeat |
1.0E-10 |
Pfam |
IPR000557 EMBL-EBI |
Calponin repeat |
5.5E-9 |
Pfam |
IPR000557 EMBL-EBI |
Calponin repeat |
3.8E-8 |
Pfam |
IPR000557 EMBL-EBI |
Calponin repeat |
7.0E-5 |
Pfam |
IPR000557 EMBL-EBI |
Calponin repeat |
1.4E-4 |
Pfam |
IPR000557 EMBL-EBI |
Calponin repeat |
2.3E-8 |
Pfam |
IPR000557 EMBL-EBI |
Calponin repeat |
4.2E-8 |
Pfam |
IPR000557 EMBL-EBI |
Calponin repeat |
1.0E-10 |
Pfam |
IPR000557 EMBL-EBI |
Calponin repeat |
5.5E-9 |
Pfam |
IPR000557 EMBL-EBI |
Calponin repeat |
3.8E-8 |
Pfam |
IPR000557 EMBL-EBI |
Calponin repeat |
7.0E-5 |
Pfam |
IPR000557 EMBL-EBI |
Calponin repeat |
1.4E-4 |
Pfam |
IPR000557 EMBL-EBI |
Calponin repeat |
2.3E-8 |
Pfam |
IPR000557 EMBL-EBI |
Calponin repeat |
4.2E-8 |
Pfam |
IPR000557 EMBL-EBI |
Calponin repeat |
1.0E-10 |
Pfam |
IPR000557 EMBL-EBI |
Calponin repeat |
5.5E-9 |
Pfam |
IPR000557 EMBL-EBI |
Calponin repeat |
3.8E-8 |
Pfam |
IPR000557 EMBL-EBI |
Calponin repeat |
7.0E-5 | |
Sequence |
|
>C. ELEGANS:171924_X_AT
aggtgtctgagaccatcattccaagtcaaagctggatggaacaagggagactcacagaag
aagatgacatcattcggagcaccacgtgacgttaagggcaagcacttgaagagaatctgg
gagcttgaatacccagaagaggctgaaatctctttggatcgtctctaaatcnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnntnacatgatacctgtgcataatttgcttcaacttctt
ctccaaatgtttcttctta
BLASTn GenBank NR |
|
|
|
|
|
|
AGGTGTCTGAGACCATCATTCCAAG |
52 |
59 |
13 |
Antisense |
GACCATCATTCCAAGTCAAAGCTGG |
568 |
383 |
23 |
Antisense |
GGATGGAACAAGGGAGACTCACAGA |
284 |
515 |
46 |
Antisense |
AGATGACATCATTCGGAGCACCACG |
302 |
67 |
74 |
Antisense |
GGAGCACCACGTGACGTTAAGGGCA |
432 |
519 |
88 |
Antisense |
GGGAGCTTGAATACCCAGAAGAGGC |
656 |
493 |
131 |
Antisense |
GGCTGAAATCTCTTTGGATCGTCTC |
705 |
539 |
153 |
Antisense |
AATCTCTTTGGATCGTCTCTAAATC |
696 |
167 |
159 |
Antisense |
ACATGATACCTGTGCATAATTTGCT |
161 |
105 |
218 |
Antisense |
TAATTTGCTTCAACTTCTTCTCCAA |
324 |
635 |
234 |
Antisense |
CTTCTTCTCCAAATGTTTCTTCTTA |
397 |
221 |
247 |
Antisense | |
|
Affymetrix Proprietary Database |