|
|
Cluster Members Consensus/Exemplar Group Members |
GeneChip Array Information |
|
171923_x_at |
|
C. elegans Genome Array |
|
Nematode |
Probe Design Information |
|
affy.Ce.28039
|
|
Exemplar sequence
|
|
CEK073DXR NCBI
|
|
CEK073DXR_rc /REP_DB=TREMBL Accession /GB=D66076 /FEA=Transcript Cluster /DEF=C.elegans cDNA clone yk73d10 : 3prime end, single read.
|
This cluster is supported by a Transcript Cluster. |
Annotation Method Description |
|
This probe set was annotated using the Genome Target Overlap based pipeline to a RefSeq identifier using 1 transcript(s). |
|
This is a grade B annotation. |
|
NM_064363 |
|
|
|
|
|
GENEFINDER00000020293 ENSEMBL |
cdna:GeneFinder chromosome:CEL140:II:12994364:12996089:-1 |
|
None |
Y38F1A.6.2 ENSEMBL |
cdna:known chromosome:CEL140:II:12994262:12996464:-1 gene:Y38F1A.6 |
|
A |
Y38F1A.6.1 ENSEMBL |
cdna:known chromosome:CEL140:II:12994262:12996309:-1 gene:Y38F1A.6 |
|
A |
SNAP00000020282 ENSEMBL |
cdna:SNAP chromosome:CEL140:II:12994364:12996089:-1 |
|
None |
Y38F1A.6.3 ENSEMBL |
cdna:known chromosome:CEL140:II:12994269:12996511:-1 gene:Y38F1A.6 |
|
A |
NM_064363 NCBI |
Caenorhabditis elegans Y38F1A.6 (Y38F1A.6) mRNA, complete cds. |
|
A | |
There are no noteworthy cross hybridizing mRNAs found for this probe set. | |
Genomic Alignment of Consensus/Exemplar Sequence |
|
Wormbase March 2004 |
|
|
|
|
|
chrII:12994270-12994633(-) |
87.39 |
87.39 |
| |
Public Domain and Genome References |
|
Iron-containing alcohol dehydrogenases
|
|
Y38F1A.6
|
|
174942 Entrez gene
|
|
Q9U2M4 EMBL-EBI
|
|
CE24222 Wormbase
|
Functional Annotations |
|
|
|
|
CANINE:1602528_AT |
similar to alcohol dehydrogenase, iron containing, 1 |
cfa |
CANINE:1593452_AT |
similar to alcohol dehydrogenase, iron containing, 1 |
cfa |
CANINE_2:CFA.14010.1.A1_AT |
similar to alcohol dehydrogenase, iron containing, 1 |
cfa |
CANINE_2:CFA.9585.1.A1_AT |
similar to alcohol dehydrogenase, iron containing, 1 |
cfa |
CANINE_2:CFAAFFX.11851.1.S1_AT |
similar to alcohol dehydrogenase, iron containing, 1 |
cfa |
DROSOPHILA_2:1628907_AT |
Type III alcohol dehydrogenase |
dm |
DROSGENOME1:143891_AT |
Type III alcohol dehydrogenase |
dm |
CHICKEN:GGA.16991.2.S1_A_AT |
alcohol dehydrogenase, iron containing, 1 |
gga |
HU35KSUBA:R63545_AT |
alcohol dehydrogenase, iron containing, 1 |
hs |
HU35KSUBB:RC_R92768_AT |
alcohol dehydrogenase, iron containing, 1 |
hs |
HU35KSUBB:RC_H48457_AT |
alcohol dehydrogenase, iron containing, 1 |
hs |
U133_X3P:HS.184261.0.A1_3P_AT |
alcohol dehydrogenase, iron containing, 1 |
hs |
HG-U133_PLUS_2:227113_AT |
alcohol dehydrogenase, iron containing, 1 |
hs |
HG-U133B:227113_AT |
alcohol dehydrogenase, iron containing, 1 |
hs |
HG-U95B:44426_AT |
alcohol dehydrogenase, iron containing, 1 |
hs |
HG-U95B:48601_AT |
alcohol dehydrogenase, iron containing, 1 |
hs |
HU35KSUBD:RC_N39016_AT |
Alcohol dehydrogenase, iron containing, 1 |
hs |
MG-U74BV2:108537_AT |
alcohol dehydrogenase, iron containing, 1 |
mm |
MG-U74CV2:128834_R_AT |
alcohol dehydrogenase, iron containing, 1 |
mm |
MOE430A:1424392_AT |
alcohol dehydrogenase, iron containing, 1 |
mm |
MOUSE430A_2:1424392_AT |
alcohol dehydrogenase, iron containing, 1 |
mm |
MOUSE430_2:1424392_AT |
alcohol dehydrogenase, iron containing, 1 |
mm |
MOE430A:1424393_S_AT |
alcohol dehydrogenase, iron containing, 1 |
mm |
MOUSE430A_2:1424393_S_AT |
alcohol dehydrogenase, iron containing, 1 |
mm |
MOUSE430_2:1424393_S_AT |
alcohol dehydrogenase, iron containing, 1 |
mm |
MOE430B:1444193_AT |
alcohol dehydrogenase, iron containing, 1 |
mm |
MOUSE430_2:1444193_AT |
alcohol dehydrogenase, iron containing, 1 |
mm |
MU19KSUBA:TC16926_AT |
Alcohol dehydrogenase, iron containing, 1, mRNA (cDNA clone MGC:37234 IMAGE:4972323) |
mm |
MU19KSUBC:TC41391_AT |
Alcohol dehydrogenase, iron containing, 1, mRNA (cDNA clone MGC:37234 IMAGE:4972323) |
mm |
MU19KSUBC:TC41391_G_AT |
Alcohol dehydrogenase, iron containing, 1, mRNA (cDNA clone MGC:37234 IMAGE:4972323) |
mm |
RG-U34C:AA848389_AT |
alcohol dehydrogenase, iron containing, 1 (predicted) |
rn |
RG-U34C:AA942889_AT |
alcohol dehydrogenase, iron containing, 1 (predicted) |
rn |
RG-U34C:RC_AI072214_AT |
alcohol dehydrogenase, iron containing, 1 (predicted) |
rn |
RAE230A:1389548_AT |
alcohol dehydrogenase, iron containing, 1 (predicted) |
rn |
RAT230_2:1389548_AT |
alcohol dehydrogenase, iron containing, 1 (predicted) |
rn |
RAE230B:1384073_AT |
alcohol dehydrogenase, iron containing, 1 (predicted) |
rn |
RAT230_2:1384073_AT |
alcohol dehydrogenase, iron containing, 1 (predicted) |
rn | |
|
|
|
|
|
8152 |
metabolism |
inferred from electronic annotation |
QuickGO AmiGO |
|
|
|
|
5506 |
iron ion binding |
inferred from electronic annotation |
QuickGO AmiGO |
16491 |
oxidoreductase activity |
inferred from electronic annotation |
QuickGO AmiGO | |
|
|
|
|
|
blast |
CAA21631 |
Hypothetical protein Y38F1A.6 [Caenorhabditis elegans] ref|NP_496764.1| Y38F1A.6 [Caenorhabditis elegans] |
0.0 |
blast |
CAE59405 |
Hypothetical protein CBG02769 [Caenorhabditis briggsae] |
0.0 | |
|
|
|
|
|
Pfam |
IPR001670 EMBL-EBI |
Iron-containing alcohol dehydrogenase |
5.0E-40 |
Pfam |
IPR001670 EMBL-EBI |
Iron-containing alcohol dehydrogenase |
1.2E-10 | |
Sequence |
|
>C. ELEGANS:171923_X_AT
attccagcaatgaggacatttcccgaactctttgtgatcgnctgagaggttatatgcgag
actttggagtaaccaaatggactgtcaggaatgggattcgaattttctgattgtgaaatg
cttactgaagcagccatccactccgtcccagatattccaatctctcccaagtctgcggat
cgtgaacattatcagcactctggacgagaagtccccnctntgtattagtcannnnnnnnn
nnnnnnnnnnnnnnnnnnnnnttgtaccatatacgttattgtttgctt
BLASTn GenBank NR |
|
|
|
|
|
|
ATTCCAGCAATGAGGACATTTCCCG |
595 |
5 |
27 |
Antisense |
GACATTTCCCGAACTCTTTGTGATC |
159 |
371 |
41 |
Antisense |
GAGAGGTTATATGCGAGACTTTGGA |
680 |
395 |
70 |
Antisense |
ATGGACTGTCAGGAATGGGATTCGA |
111 |
53 |
103 |
Antisense |
GGGATTCGAATTTTCTGATTGTGAA |
269 |
497 |
119 |
Antisense |
TGCTTACTGAAGCAGCCATCCACTC |
177 |
579 |
145 |
Antisense |
CTCTCCCAAGTCTGCGGATCGTGAA |
497 |
231 |
188 |
Antisense |
AAGTCTGCGGATCGTGAACATTATC |
94 |
157 |
195 |
Antisense |
GAACATTATCAGCACTCTGGACGAG |
349 |
351 |
210 |
Antisense |
TCAGCACTCTGGACGAGAAGTCCCC |
210 |
625 |
218 |
Antisense |
GTACCATATACGTTATTGTTTGCTT |
108 |
459 |
290 |
Antisense | |
|
Affymetrix Proprietary Database | |