|
|
Cluster Members Consensus/Exemplar Group Members |
GeneChip Array Information |
|
171758_x_at |
|
C. elegans Genome Array |
|
Nematode |
Probe Design Information |
|
affy.Ce.25756
|
|
Exemplar sequence
|
|
CEK004C7F NCBI
|
|
CEK004C7F /REP_DB=TREMBL Accession /5_PRIME_EXT_ID=F49E2.5E /5_PRIME_EXT_DB=WormBase Gene ID /GB=D27443 /WB_GENE_ID=F49E2.5E /WP=CE16091 /CHR=X /FEA=Genomic Cluster /DEF=C.elegans cDNA clone yk4c7 : 5prime end, single read.
|
This cluster is supported by a Genomic Cluster. |
Annotation Method Description |
|
This probe set was annotated using the Matching Probes based pipeline to a RefSeq identifier using 1 transcript(s). |
|
This is a grade A annotation. |
|
NM_001029524(9), NM_077204(9), NM_001029523(9), NM_077208(9), NM_171968(9), NM_077209(10) |
|
|
|
|
|
NM_001029524 NCBI |
Caenorhabditis elegans F49E2.5j (F49E2.5) mRNA, complete cds. |
9/11 |
None |
NM_077204 NCBI |
Caenorhabditis elegans F49E2.5a (F49E2.5) mRNA, complete cds. |
9/11 |
A |
NM_001029523 NCBI |
Caenorhabditis elegans F49E2.5i (F49E2.5) mRNA, complete cds. |
9/11 |
None |
NM_077208 NCBI |
Caenorhabditis elegans F49E2.5f (F49E2.5) mRNA, complete cds. |
9/11 |
A |
NM_171968 NCBI |
Caenorhabditis elegans F49E2.5g (F49E2.5) mRNA, complete cds. |
9/11 |
A |
NM_077209 NCBI |
Caenorhabditis elegans F49E2.5e (F49E2.5) mRNA, complete cds. |
10/11 |
A |
SNAP00000006377 ENSEMBL |
cdna:SNAP chromosome:CEL140:X:9552823:9559810:1 |
9/11 |
None |
GENEFINDER00000006386 ENSEMBL |
cdna:GeneFinder chromosome:CEL140:X:9552823:9559810:1 |
9/11 |
None |
F49E2.5a ENSEMBL |
cdna:known chromosome:CEL140:X:9552823:9559810:1 gene:F49E2.5 |
9/11 |
A |
F49E2.5e ENSEMBL |
cdna:known chromosome:CEL140:X:9552823:9558426:1 gene:F49E2.5 |
10/11 |
A |
F49E2.5f ENSEMBL |
cdna:known chromosome:CEL140:X:9552823:9555527:1 gene:F49E2.5 |
9/11 |
A |
F49E2.5g ENSEMBL |
cdna:known chromosome:CEL140:X:9552823:9555527:1 gene:F49E2.5 |
9/11 |
A | |
NM_077205 |
2/11 |
Cross Hyb Matching Probes |
A |
F49E2.5d.1 |
2/11 |
Cross Hyb Matching Probes |
A |
F49E2.5d.2 |
2/11 |
Cross Hyb Matching Probes |
A | |
181175 |
10 |
6 |
NM_001029522 |
180309_s_at (10) |
|
|
|
NM_001029523 |
171758_x_at (9), 172298_x_at (10), 180309_s_at (10) |
|
|
|
NM_001029524 |
171758_x_at (9), 172298_x_at (10), 174674_at (11), 180098_s_at (11), 180309_s_at (10) |
|
|
|
NM_077204 |
171758_x_at (9), 172298_x_at (10), 180309_s_at (10) |
|
|
|
NM_077205 |
180309_s_at (10) |
|
|
|
NM_077206 |
180309_s_at (10) |
|
|
|
NM_077207 |
180309_s_at (10) |
|
|
|
NM_077208 |
171758_x_at (9), 172298_x_at (10), 180098_s_at (11) |
|
|
|
NM_077209 |
171758_x_at (10), 172298_x_at (11), 180098_s_at (11) |
|
|
|
NM_171968 |
171758_x_at (9), 172298_x_at (10), 180098_s_at (11) | |
Genomic Alignment of Consensus/Exemplar Sequence |
|
Wormbase March 2004 |
|
|
|
|
|
chrX:9552823-9555348(+) |
96.11 |
100.0 |
| |
Public Domain and Genome References |
|
F49E2.5
|
Functional Annotations |
|
|
|
|
|
blast |
CAI79255 |
Hypothetical protein F49E2.5j [Caenorhabditis elegans] ref|NP_001024695.1| F49E2.5j [Caenorhabditis elegans] |
0.0 |
blast |
CAA86429 |
Hypothetical protein F49E2.5b [Caenorhabditis elegans] ref|NP_509607.2| F49E2.5b [Caenorhabditis elegans] |
0.0 |
blast |
CAH04746 |
Hypothetical protein F49E2.5h [Caenorhabditis elegans] ref|NP_001024693.1| F49E2.5h [Caenorhabditis elegans] |
0.0 |
blast |
CAA86428 |
Hypothetical protein F49E2.5a [Caenorhabditis elegans] ref|NP_509605.2| F49E2.5a [Caenorhabditis elegans] |
0.0 |
blast |
CAA86424 |
Hypothetical protein F49E2.5c [Caenorhabditis elegans] ref|NP_509608.2| F49E2.5c [Caenorhabditis elegans] |
0.0 |
blast |
CAI79254 |
Hypothetical protein F49E2.5i [Caenorhabditis elegans] ref|NP_001024694.1| F49E2.5i [Caenorhabditis elegans] |
0.0 | |
|
|
|
|
|
Pfam |
IPR006836 EMBL-EBI |
Protein of unknown function DUF612 |
1.0E-126 |
Pfam |
IPR006836 EMBL-EBI |
Protein of unknown function DUF612 |
6.1E-15 |
Pfam |
IPR006836 EMBL-EBI |
Protein of unknown function DUF612 |
2.3E-7 |
Pfam |
IPR006836 EMBL-EBI |
Protein of unknown function DUF612 |
9.2E-50 |
Pfam |
IPR006836 EMBL-EBI |
Protein of unknown function DUF612 |
3.4E-10 |
Pfam |
IPR006836 EMBL-EBI |
Protein of unknown function DUF612 |
1.0E-126 |
Pfam |
IPR006836 EMBL-EBI |
Protein of unknown function DUF612 |
1.7E-95 |
Pfam |
IPR006836 EMBL-EBI |
Protein of unknown function DUF612 |
6.1E-15 |
Pfam |
IPR006836 EMBL-EBI |
Protein of unknown function DUF612 |
3.4E-10 |
Pfam |
IPR006836 EMBL-EBI |
Protein of unknown function DUF612 |
7.4E-56 |
Pfam |
IPR006836 EMBL-EBI |
Protein of unknown function DUF612 |
6.8E-50 |
Pfam |
IPR006836 EMBL-EBI |
Protein of unknown function DUF612 |
1.0E-126 |
Pfam |
IPR006836 EMBL-EBI |
Protein of unknown function DUF612 |
1.0E-126 |
Pfam |
IPR006836 EMBL-EBI |
Protein of unknown function DUF612 |
6.1E-15 |
Pfam |
IPR006836 EMBL-EBI |
Protein of unknown function DUF612 |
1.4E-15 |
Pfam |
IPR006836 EMBL-EBI |
Protein of unknown function DUF612 |
2.3E-7 |
Pfam |
IPR006836 EMBL-EBI |
Protein of unknown function DUF612 |
4.9E-32 |
Pfam |
IPR006836 EMBL-EBI |
Protein of unknown function DUF612 |
9.7E-9 |
Pfam |
IPR006836 EMBL-EBI |
Protein of unknown function DUF612 |
1.4E-15 |
Pfam |
IPR006836 EMBL-EBI |
Protein of unknown function DUF612 |
2.3E-7 |
Pfam |
IPR006836 EMBL-EBI |
Protein of unknown function DUF612 |
4.9E-32 |
Pfam |
IPR006836 EMBL-EBI |
Protein of unknown function DUF612 |
9.7E-9 | |
Sequence |
|
>C. ELEGANS:171758_X_AT
gagcaaccggtggaatctgctccagctccaccacaagttgaacaagttgttgaggctacc
ccaccggcatctgaaaacaaaaagaaaaataagaaagacaagaagaagagtgaaagcgag
aaggctgttgaagagccagttcaagctgcgccctcatccaaaaagcctactgctgatgac
agcatggacttcttggactttgttactgctaaacctgaccgctccgaagtggcagctcca
gttgaggttgccaaggtagatgaatctaccgcagtcacctcagaaaacaggaaaaagaac
aagaaggacaagaaaaagagtgagagtgaaaaagcagttgaggagccagttcaggctgct
ccaacatccaaaaaaccaactgctgatgatagcatggactttttggatttcgtaactgct
aaggaagaacgtgttgaagaagtggctccagttcaagagcaagtaaaagagcaaaaggtg
atttcagatgaatgttttcttgttatgctatttgcacgagactcttgtccaatcca
BLASTn GenBank NR |
|
|
|
|
|
|
GAGCAACCGGTGGAATCTGCTCCAG |
380 |
391 |
1191 |
Antisense |
TCCAGCTCCACCACAAGTTGAACAA |
101 |
591 |
1211 |
Antisense |
GAACAAGTTGTTGAGGCTACCCCAC |
633 |
351 |
1230 |
Antisense |
TGAAGAGCCAGTTCAAGCTGCGCCC |
345 |
575 |
1319 |
Antisense |
GACAGCATGGACTTCTTGGACTTTG |
186 |
369 |
1368 |
Antisense |
TTTGTTACTGCTAAACCTGACCGCT |
295 |
665 |
1389 |
Antisense |
GCAGCTCCAGTTGAGGTTGCCAAGG |
172 |
313 |
1422 |
Antisense |
TAGATGAATCTACCGCAGTCACCTC |
517 |
653 |
1447 |
Antisense |
GAGGAGCCAGTTCAGGCTGCTCCAA |
707 |
403 |
1530 |
Antisense |
GCTGCTCCAACATCCAAAAAACCAA |
91 |
297 |
1545 |
Antisense |
TTGCACGAGACTCTTGTCCAATCCA |
22 |
703 |
1702 |
Antisense | |
|
Affymetrix Proprietary Database |