[Home] | [Total List]

[193899_at] beta-1,6-N-acetylglucosaminyltransferase like

Description C54C8.11 /REP_DB=WormBase Gene ID /WP=CE19770 /GEN=gly-15 /TR=O02234 /GB=CAB05469.1 /SUBMIT=HINXTON /CHR=1 /FEA=Sanger Annotation /DEF=beta-1,6-N-acetylglucosaminyltransferase like
Cluster 6grp_total > 20      4grp_total > 17      6grp_cgc > 53      6grp_cgc_sub > 02      6grp_total_sub > Hat      

Scale

Warning: fopen(./gnuplot/193899_at_1_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/193899_at_1_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/193899_at_2_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/193899_at_2_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252
G range Absolute graph Relative graph Expression Table Dauer Comp.
4 110
1 2 3 4 range
A 7.6
(-3)
A
33.4
(-1.6)
A
11.8
(-2.8)
A
117.5
(3)
A
110
B 24.4
(-3)
A
37
(-1.7)
A
75.8
(2.5)
A
80.9
(3)
A
57
C 12.9
(-2.5)
A
39.5
(0.4)
A
8.7
(-3)
A
62.7
(3)
A
54
avr 15
(-3)
36.6
(-1.2)
32.1
(-1.6)
87
(3)
72

Warning: fopen(./gnuplot/193899_at_dSignal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/193899_at_dSignal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

1 : 1 state (S1, L1)
2 : dauer (ST, LT)
6 46
1 2 3 4 5 6 range
A 15.6
(-1.5)
A
8.6
(-3)
A
35.8
(3)
A
14.5
(-1.7)
A
11.4
(-2.4)
A
10.9
(-2.5)
A
27
B 8.8
(-2.4)
A
48.4
(3)
A
8.9
(-2.4)
A
9.3
(-2.4)
A
10.2
(-2.3)
A
4.8
(-3)
A
44
C 8.4
(0.9)
A
11.5
(3)
A
3.8
(-2.1)
A
8.6
(1.1)
A
2.5
(-3)
A
7.4
(0.3)
A
9
avr 10.9
(-1.7)
22.8
(3)
16.2
(0.4)
10.8
(-1.8)
8
(-2.9)
7.7
(-3)
15
No Scale

Warning: fopen(./gnuplot/193899_at_1_No_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/193899_at_1_No_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/193899_at_2_No_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/193899_at_2_No_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252
G range Absolute graph Relative graph Expression Table Dauer Comp.
4 15
1 2 3 4 range
A 2.8
(-3)
A
7.2
(-1.2)
A
3.1
(-2.9)
A
17.2
(3)
A
14
B 7.8
(-3)
A
9.1
(-2.2)
A
17.6
(3)
A
17.2
(2.8)
A
10
C 4.3
(-2.1)
A
11.4
(3)
A
3
(-3)
A
10.6
(2.4)
A
8
avr 5
(-3)
9.2
(-0.5)
7.9
(-1.3)
15
(3)
10

Warning: fopen(./gnuplot/193899_at_dNo_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/193899_at_dNo_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

1 : 1 state (S1, L1)
2 : dauer (ST, LT)
6 15
1 2 3 4 5 6 range
A 2.9
(-2.7)
A
3.1
(-2.4)
A
7.8
(3)
A
3.7
(-1.7)
A
3.5
(-2)
A
2.6
(-3)
A
5
B 3.1
(-2.5)
A
16.1
(3)
A
2.2
(-2.8)
A
2.5
(-2.7)
A
4.2
(-2)
A
1.8
(-3)
A
14
C 3.1
(2.1)
A
3.5
(3)
A
1
(-2.6)
A
1.7
(-1)
A
0.8
(-3)
A
2.5
(0.8)
A
3
avr 3
(-2.2)
7.6
(3)
3.7
(-1.4)
2.6
(-2.7)
2.8
(-2.4)
2.3
(-3)
5
NetAffx Links Cluster Members
Consensus/Exemplar
GeneChip Array Information
Probe Set ID 193899_at
GeneChip Array C. elegans Genome Array
Organism Common Name Nematode
Probe Design Information
Transcript ID(Array Design) affy.Ce.1030
Sequence Type Exemplar sequence
Representative Public ID C54C8.11 NCBI
Target Description C54C8.11 /REP_DB=WormBase Gene ID /WP=CE19770 /GEN=gly-15 /TR=O02234 /GB=CAB05469.1 /SUBMIT=HINXTON /CHR=1 /FEA=Sanger Annotation /DEF=beta-1,6-N-acetylglucosaminyltransferase like
Cluster Evidence This cluster is supported by a Sanger Annotation.
Annotation Method Description
Annotation Description This probe set was annotated using the Matching Probes based pipeline to a RefSeq identifier using 1 transcript(s).
Annotation Grade This is a grade A annotation.
Annotation Transcript Cluster (# of Matching Probes) NM_060763(10)
Transcript Assignments
Representative
Transcript
Description Matching Probes Related Probesets by Grade
NM_060763 NCBI Caenorhabditis elegans GLYcosylation related family member (gly-15) (gly-15) mRNA, complete cds. 10/11 None
C54C8.11 ENSEMBL cdna:known chromosome:CEL140:I:12470297:12473937:1 gene:C54C8.11 11/11 None
Annotation Notes
Cross Hybridizing mRNA Matched Probes Nature of Assignment Related Probesets by Grade
SNAP00000037287 1/11 Cross Hyb Matching Probes None
GENEFINDER00000037288 5/11 Cross Hyb Matching Probes None
Genomic Alignment of Consensus/Exemplar Sequence
Assembly Wormbase March 2004
Alignment(s)
Position Identity Coverage Cytoband
chrI:12470227-12473868(+) 100.0 100.0
Public Domain and Genome References
Gene Title beta-1,6-N-acetylglucosaminyltransferase like
Gene Symbol gly-15
Ensembl C54C8.11
Entrez Gene 173114 Entrez gene
SwissProt O02234 EMBL-EBI
WormBase CE38301 Wormbase
Functional Annotations
Ortholog
ID Title Organism
CANINE_2:CFAAFFX.3383.1.S1_AT similar to beta-1,3-galactosyl-O-glycosyl-glycoprotein beta-1,6-N-acetylglucosaminyltransferase cfa
CHICKEN:GGAAFFX.9648.1.S1_AT similar to enzymatic glycosylation-regulating gene gga
HG-U133_PLUS_2:205505_AT glucosaminyl (N-acetyl) transferase 1, core 2 (beta-1,6-N-acetylglucosaminyltransferase) hs
HG-FOCUS:205505_AT glucosaminyl (N-acetyl) transferase 1, core 2 (beta-1,6-N-acetylglucosaminyltransferase) hs
HG-U133A:205505_AT glucosaminyl (N-acetyl) transferase 1, core 2 (beta-1,6-N-acetylglucosaminyltransferase) hs
HG-U133A_2:205505_AT glucosaminyl (N-acetyl) transferase 1, core 2 (beta-1,6-N-acetylglucosaminyltransferase) hs
HG-U95C:57697_AT glucosaminyl (N-acetyl) transferase 1, core 2 (beta-1,6-N-acetylglucosaminyltransferase) hs
HU35KSUBB:RC_AA171692_AT glucosaminyl (N-acetyl) transferase 1, core 2 (beta-1,6-N-acetylglucosaminyltransferase) hs
HUGENEFL:M97347_S_AT glucosaminyl (N-acetyl) transferase 1, core 2 (beta-1,6-N-acetylglucosaminyltransferase) hs
HUGENEFL:L41390_AT glucosaminyl (N-acetyl) transferase 1, core 2 (beta-1,6-N-acetylglucosaminyltransferase) hs
U133_X3P:G4503960_3P_AT glucosaminyl (N-acetyl) transferase 1, core 2 (beta-1,6-N-acetylglucosaminyltransferase) hs
U133_X3P:HS.122329.0.A1_3P_AT glucosaminyl (N-acetyl) transferase 1, core 2 (beta-1,6-N-acetylglucosaminyltransferase) hs
HG-U133_PLUS_2:239761_AT glucosaminyl (N-acetyl) transferase 1, core 2 (beta-1,6-N-acetylglucosaminyltransferase) hs
HG-U133B:239761_AT glucosaminyl (N-acetyl) transferase 1, core 2 (beta-1,6-N-acetylglucosaminyltransferase) hs
HG-U95AV2:38218_AT glucosaminyl (N-acetyl) transferase 1, core 2 (beta-1,6-N-acetylglucosaminyltransferase) hs
HG-U95E:81655_AT glucosaminyl (N-acetyl) transferase 1, core 2 (beta-1,6-N-acetylglucosaminyltransferase) hs
HG-U95E:89677_AT glucosaminyl (N-acetyl) transferase 1, core 2 (beta-1,6-N-acetylglucosaminyltransferase) hs
HG-U95B:44454_AT Glucosaminyl (N-acetyl) transferase 1, core 2 (beta-1,6-N-acetylglucosaminyltransferase) hs
HU35KSUBD:RC_AA620472_AT Glucosaminyl (N-acetyl) transferase 1, core 2 (beta-1,6-N-acetylglucosaminyltransferase) hs
MU11KSUBA:D87332_S_AT glucosaminyl (N-acetyl) transferase 1, core 2 mm
MU11KSUBB:MSA.1398.0_S_AT glucosaminyl (N-acetyl) transferase 1, core 2 mm
MG-U74AV2:92655_AT glucosaminyl (N-acetyl) transferase 1, core 2 mm
MG-U74BV2:112807_AT glucosaminyl (N-acetyl) transferase 1, core 2 mm
MG-U74BV2:162936_AT glucosaminyl (N-acetyl) transferase 1, core 2 mm
MG-U74CV2:170045_R_AT glucosaminyl (N-acetyl) transferase 1, core 2 mm
MOE430A:1449538_A_AT glucosaminyl (N-acetyl) transferase 1, core 2 mm
MOUSE430A_2:1449538_A_AT glucosaminyl (N-acetyl) transferase 1, core 2 mm
MOUSE430_2:1449538_A_AT glucosaminyl (N-acetyl) transferase 1, core 2 mm
MOE430B:1460431_AT glucosaminyl (N-acetyl) transferase 1, core 2 mm
MOUSE430_2:1460431_AT glucosaminyl (N-acetyl) transferase 1, core 2 mm
MU19KSUBB:TC31126_AT Glucosaminyl (N-acetyl) transferase 1, core 2, mRNA (cDNA clone MGC:11452 IMAGE:3154671) mm
RG-U34A:S79797_AT glucosaminyl (N-acetyl) transferase 1, core 2 rn
RAE230A:1368770_AT glucosaminyl (N-acetyl) transferase 1, core 2 rn
RAT230_2:1368770_AT glucosaminyl (N-acetyl) transferase 1, core 2 rn
Protein Similarities
Method ID Description E-Value
blast CAB05469 Hypothetical protein C54C8.11 [Caenorhabditis elegans] emb|CAA21769.2| Hypothetical protein C54C8.11 [Caenorhabditis elegans] ref|NP_493164.2| GLYcosylation related family member (gly-15) [Caenorhabditis elegans] 0.0
blast CAE60700 Hypothetical protein CBG04363 [Caenorhabditis briggsae] 1.0E-172
blast CAE60700 Hypothetical protein CBG04363 [Caenorhabditis briggsae] 1.0E-169
blast AAK94759 GLY-15 [Caenorhabditis elegans] 1.0E-106
Protein Domains
Database ID Description E-Value
Pfam IPR003406 EMBL-EBI Glycosyl transferase, family 14 1.8E-88
Pfam IPR003406 EMBL-EBI Glycosyl transferase, family 14 2.2E-88
Trans Membrane
ID Number Of Domains Domain Boundaries
NP_493164.2 1 5-27
C54C8.11 1 5-27
Sequence
Target Sequence
>C. ELEGANS:193899_AT
attgccgttcgagttttatcgcttgaatcggaaaaggccttggagctccccacttccact
gtacaaaacgtcactttcagcgactttttccagaaaatctgcaaattttatggttaatag
tgagaaagttctagaacaaatcgattttctacgtggcacaacgtgcgccgacgagtcgct
atgggcaactattgctgggaatcctaaggttattaaattttcagagctcccaatgcctgg
aggttttgatgctaaagcttggatccacaaaaattaccgccggacacgtgggaaactggg
aaaatacggagaaaatcaaaaaatcgataatgggtactatgtgtcgaggtaccaacagta
tgtgaatagggcgccggtcaagtgtaaaggttactattatcgactatcgtgtgtttttgg
agtgtatgatttgccgaatttgataaaccgccacgaacttgttgctcacaaactctactt
ttcctaccagccagctgcatttatgtgtct


BLASTn GenBank NR
Probe Info
Probe Sequence(5'-3') Probe X Probe Y Probe Interrogation
Position
Strandedness
ATTGCCGTTCGAGTTTTATCGCTTG 245 7 687 Antisense
CCCACTTCCACTGTACAAAACGTCA 54 255 735 Antisense
AAATCGATTTTCTACGTGGCACAAC 472 117 824 Antisense
TGCGCCGACGAGTCGCTATGGGCAA 312 583 850 Antisense
GGCAACTATTGCTGGGAATCCTAAG 364 533 870 Antisense
CAGAGCTCCCAATGCCTGGAGGTTT 275 205 908 Antisense
TTACCGCCGGACACGTGGGAAACTG 265 669 960 Antisense
GTGAATAGGGCGCCGGTCAAGTGTA 29 461 1048 Antisense
GATAAACCGCCACGAACTTGTTGCT 606 421 1128 Antisense
TGTTGCTCACAAACTCTACTTTTCC 418 563 1146 Antisense
ACCAGCCAGCTGCATTTATGTGTCT 86 87 1172 Antisense
Sequence Source Affymetrix Proprietary Database