[Home] | [Total List]

[193608_at] tyrosine-protein kinase (KIN15/KIN16 subfamily)

Description R09D1.12 /REP_DB=WormBase Gene ID /WP=CE28068 /TR=Q21867 /GB=CAA93871.2 /SUBMIT=HINXTON /CHR=2 /FEA=Sanger Annotation /DEF=tyrosine-protein kinase (KIN15-KIN16 subfamily)
Cluster 6grp_total > 97      4grp_total > 02      6grp_total_sub > Increase      6grp_rule_based > S6      4grp_rule_based > L4      

Scale

Warning: fopen(./gnuplot/193608_at_1_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/193608_at_1_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/193608_at_2_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/193608_at_2_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252
G range Absolute graph Relative graph Expression Table Dauer Comp.
4 349
1 2 3 4 range
A 2
(-3)
A
4
(-2.9)
A
6.5
(-2.9)
A
226.2
(3)
P
224
B 14.9
(-2.8)
A
5.2
(-3)
A
3
(-3)
A
351
(3)
P
348
C 5
(-2.9)
A
6.1
(-2.9)
A
1.9
(-3)
A
288.3
(3)
P
286
avr 7.3
(-2.9)
5.1
(-3)
3.8
(-3)
288.5
(3)
285

Warning: fopen(./gnuplot/193608_at_dSignal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/193608_at_dSignal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

1 : 1 state (S1, L1)
2 : dauer (ST, LT)
6 206
1 2 3 4 5 6 range
A 3.1
(-3)
A
2.7
(-3)
A
39.6
(-1.5)
A
41.9
(-1.5)
A
119
(1.6)
P
154.8
(3)
P
152
B 2.8
(-3)
A
3.6
(-3)
A
4.7
(-2.9)
A
62.2
(-1.3)
A
100.9
(-0.1)
P
207.9
(3)
P
205
C 2.2
(-3)
A
29
(-2)
A
6.9
(-2.8)
A
58.6
(-0.8)
A
97.6
(0.7)
P
157.3
(3)
P
155
avr 2.7
(-3)
11.8
(-2.7)
17.1
(-2.5)
54.2
(-1.2)
105.8
(0.6)
173.3
(3)
171
No Scale

Warning: fopen(./gnuplot/193608_at_1_No_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/193608_at_1_No_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/193608_at_2_No_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/193608_at_2_No_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252
G range Absolute graph Relative graph Expression Table Dauer Comp.
4 74
1 2 3 4 range
A 0.7
(-3)
A
0.9
(-3)
A
1.7
(-2.8)
A
33.1
(3)
P
32
B 4.7
(-2.7)
A
1.3
(-3)
A
0.7
(-3)
A
74.8
(3)
P
74
C 1.7
(-2.9)
A
1.8
(-2.9)
A
0.6
(-3)
A
48.6
(3)
P
48
avr 2.4
(-2.8)
1.3
(-3)
1
(-3)
52.2
(3)
51

Warning: fopen(./gnuplot/193608_at_dNo_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/193608_at_dNo_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

1 : 1 state (S1, L1)
2 : dauer (ST, LT)
6 77
1 2 3 4 5 6 range
A 0.6
(-3)
A
1
(-2.9)
A
8.6
(-1.7)
A
10.6
(-1.4)
A
35.9
(2.7)
P
37.7
(3)
P
37
B 1
(-3)
A
1.2
(-3)
A
1.1
(-3)
A
16.5
(-1.8)
A
41
(0.1)
P
77.5
(3)
P
77
C 0.8
(-3)
A
8.9
(-2.1)
A
1.8
(-2.9)
A
11.8
(-1.7)
A
31.6
(0.6)
P
52.7
(3)
P
52
avr 0.8
(-3)
3.7
(-2.7)
3.8
(-2.7)
13
(-1.7)
36.2
(0.8)
56
(3)
55
NetAffx Links Cluster Members
Consensus/Exemplar
GeneChip Array Information
Probe Set ID 193608_at
GeneChip Array C. elegans Genome Array
Organism Common Name Nematode
Probe Design Information
Transcript ID(Array Design) affy.Ce.3123
Sequence Type Exemplar sequence
Representative Public ID R09D1.12 NCBI
Target Description R09D1.12 /REP_DB=WormBase Gene ID /WP=CE28068 /TR=Q21867 /GB=CAA93871.2 /SUBMIT=HINXTON /CHR=2 /FEA=Sanger Annotation /DEF=tyrosine-protein kinase (KIN15-KIN16 subfamily)
Cluster Evidence This cluster is supported by a Sanger Annotation.
Annotation Method Description
Annotation Description This probe set was annotated using the Matching Probes based pipeline to a RefSeq identifier using 1 transcript(s).
Annotation Grade This is a grade A annotation.
Annotation Transcript Cluster (# of Matching Probes) NM_063624(11)
Transcript Assignments
Representative
Transcript
Description Matching Probes Related Probesets by Grade
NM_063624 NCBI Caenorhabditis elegans R09D1.12 (R09D1.12) mRNA, complete cds. 11/11 None
GENEFINDER00000010215 ENSEMBL cdna:GeneFinder chromosome:CEL140:II:9449880:9454206:-1 11/11 None
R09D1.12 ENSEMBL cdna:known chromosome:CEL140:II:9450034:9452349:-1 gene:R09D1.12 11/11 None
Annotation Notes
Cross Hybridizing mRNA Matched Probes Nature of Assignment Related Probesets by Grade
SNAP00000010206 7/11 Cross Hyb Matching Probes None
Genomic Alignment of Consensus/Exemplar Sequence
Assembly Wormbase March 2004
Alignment(s)
Position Identity Coverage Cytoband
chrII:9450030-9452346(-) 100.0 100.0
Public Domain and Genome References
Gene Title tyrosine-protein kinase (KIN15/KIN16 subfamily)
Ensembl R09D1.12
Entrez Gene 174501 Entrez gene
SwissProt Q21867 EMBL-EBI
WormBase CE28068 Wormbase
Functional Annotations
Gene Ontology
GO Biological Process (view graph)
ID Description Evidence Links
6468 protein amino acid phosphorylation inferred from electronic annotation QuickGO AmiGO
GO Molecular Function (view graph)
ID Description Evidence Links
4672 protein kinase activity inferred from electronic annotation QuickGO AmiGO
4674 protein serine/threonine kinase activity inferred from electronic annotation QuickGO AmiGO
4713 protein-tyrosine kinase activity inferred from electronic annotation QuickGO AmiGO
5524 ATP binding inferred from electronic annotation QuickGO AmiGO
Protein Similarities
Method ID Description E-Value
blast CAA93871 Hypothetical protein R09D1.12 [Caenorhabditis elegans] ref|NP_496025.1| R09D1.12 [Caenorhabditis elegans] 0.0
blast CAA93866 Hypothetical protein R09D1.6 [Caenorhabditis elegans] ref|NP_496026.1| R09D1.6 [Caenorhabditis elegans] 0.0
blast CAA93868 Hypothetical protein R09D1.8 [Caenorhabditis elegans] ref|NP_496029.1| R09D1.8 [Caenorhabditis elegans] 0.0
blast CAB05559 Hypothetical protein M01B2.1 [Caenorhabditis elegans] ref|NP_506771.2| protein KINase family member (kin-30) [Caenorhabditis elegans] 1.0E-134
blast AAF00545 putative tyrosine kinase receptor R09D1.12 [Caenorhabditis elegans] 1.0E-100
Protein Domains
Database ID Description E-Value
Pfam IPR000719 EMBL-EBI Protein kinase 6.2E-45
Pfam IPR001223 EMBL-EBI Glycoside hydrolase, family 18 1.2E-99
Pfam IPR000719 EMBL-EBI Protein kinase 6.2E-45
Trans Membrane
ID Number Of Domains Domain Boundaries
NP_496025.1 1 61-83
R09D1.12 1 61-83
GENEFINDER00000010215 1 35-57
Sequence
Target Sequence
>C. ELEGANS:193608_AT
tatcaacatccgatctattctcgtttgcttatcaaattgcaaatgggatggagtatttgg
cgtctttaccgtgtgtgcatcgcgatttagcgctgcgaaacgtctttgtgaagaaaaata
aaattattcgaataggagacttcgggttggcaagacacaacggagataaagattattaca
aggtgaagtacagtcctgaaacaccgttacccatattttggctggctcctgagtgctttg
acgacggaacaagcttcactgaaatgacagatgtttggtcatatggtgtctgtctttttg
agttattttcactcggagcatcgccttacttagaagagtttcaaaatttctttgacccaa
tttactacgtggttgcctttttggaatcaggaaaaaggctttcttcgccaaaatattgc


BLASTn GenBank NR
Probe Info
Probe Sequence(5'-3') Probe X Probe Y Probe Interrogation
Position
Strandedness
TATCAACATCCGATCTATTCTCGTT 648 659 812 Antisense
TGGAGTATTTGGCGTCTTTACCGTG 120 549 860 Antisense
TTTACCGTGTGTGCATCGCGATTTA 296 673 876 Antisense
GCGATTTAGCGCTGCGAAACGTCTT 192 287 893 Antisense
GGAGACTTCGGGTTGGCAAGACACA 555 519 946 Antisense
GTTACCCATATTTTGGCTGGCTCCT 56 447 1017 Antisense
GCTCCTGAGTGCTTTGACGACGGAA 79 299 1036 Antisense
TGGTCATATGGTGTCTGTCTTTTTG 649 551 1087 Antisense
TATTTTCACTCGGAGCATCGCCTTA 214 661 1115 Antisense
GACCCAATTTACTACGTGGTTGCCT 26 381 1165 Antisense
AAGGCTTTCTTCGCCAAAATATTGC 556 161 1206 Antisense
Sequence Source Affymetrix Proprietary Database