[Home] | [Total List]

[193583_at] Peptidyl-prolyl cis-trans isomerases

Description ZK520.5 /REP_DB=WormBase Gene ID /WP=CE16730 /GEN=cyp-7 /TR=O46022 /GB=CAB07303.1 /SUBMIT=HINXTON /CHR=3 /FEA=Sanger Annotation /DEF=Peptidyl-prolyl cis-trans isomerases
Cluster 6grp_total > 88      4grp_total > 03      6grp_cgc > 59      6grp_cgc_sub > Da      6grp_total_sub > Increase      6grp_rule_based > S6      4grp_rule_based > L4      

Scale

Warning: fopen(./gnuplot/193583_at_1_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/193583_at_1_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/193583_at_2_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/193583_at_2_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252
G range Absolute graph Relative graph Expression Table Dauer Comp.
4 230
1 2 3 4 range
A 50.1
(-1.1)
A
3.3
(-3)
A
9.1
(-2.8)
A
153.5
(3)
A
150
B 2.5
(-3)
A
11.6
(-2.2)
A
8.2
(-2.5)
A
74.4
(3)
A
72
C 3.8
(-3)
A
13.6
(-2.7)
A
6.6
(-2.9)
A
232.4
(3)
P
229
avr 18.8
(-2.6)
9.5
(-2.9)
8
(-3)
153.4
(3)
145

Warning: fopen(./gnuplot/193583_at_dSignal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/193583_at_dSignal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

1 : 1 state (S1, L1)
2 : dauer (ST, LT)
6 345
1 2 3 4 5 6 range
A 25.8
(-2.7)
A
6.4
(-3)
A
81.2
(-1.7)
A
27.6
(-2.6)
A
177.6
(0)
A
347.8
(3)
P
341
B 59.9
(-2)
A
3
(-3)
A
80.8
(-1.6)
A
30.7
(-2.5)
A
223.7
(1)
A
337.5
(3)
P
335
C 5.5
(-3)
A
4.5
(-3)
A
5.9
(-3)
A
10.4
(-2.9)
A
127.4
(-0.3)
A
274.3
(3)
P
270
avr 30.4
(-2.5)
4.6
(-3)
56
(-2)
22.9
(-2.7)
176.2
(0.3)
319.9
(3)
315
No Scale

Warning: fopen(./gnuplot/193583_at_1_No_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/193583_at_1_No_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/193583_at_2_No_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/193583_at_2_No_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252
G range Absolute graph Relative graph Expression Table Dauer Comp.
4 39
1 2 3 4 range
A 18.3
(1.8)
A
0.7
(-3)
A
2.4
(-2.5)
A
22.5
(3)
A
22
B 0.8
(-3)
A
2.9
(-2.2)
A
1.9
(-2.6)
A
15.9
(3)
A
15
C 1.3
(-3)
A
3.9
(-2.6)
A
2.3
(-2.8)
A
39.2
(3)
P
38
avr 6.8
(-1.8)
2.5
(-2.9)
2.2
(-3)
25.9
(3)
24

Warning: fopen(./gnuplot/193583_at_dNo_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/193583_at_dNo_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

1 : 1 state (S1, L1)
2 : dauer (ST, LT)
6 125
1 2 3 4 5 6 range
A 4.8
(-2.8)
A
2.3
(-3)
A
17.7
(-1.9)
A
7
(-2.7)
A
53.6
(0.7)
A
84.7
(3)
P
82
B 20.9
(-2)
A
1
(-3)
A
19.6
(-2.1)
A
8.1
(-2.7)
A
90.9
(1.3)
A
125.8
(3)
P
125
C 2
(-3)
A
1.4
(-3)
A
1.5
(-3)
A
2.1
(-3)
A
41.2
(-0.4)
A
91.8
(3)
P
90
avr 9.2
(-2.5)
1.6
(-3)
12.9
(-2.3)
5.7
(-2.8)
61.9
(0.6)
100.8
(3)
99
NetAffx Links Cluster Members
Consensus/Exemplar
GeneChip Array Information
Probe Set ID 193583_at
GeneChip Array C. elegans Genome Array
Organism Common Name Nematode
Probe Design Information
Transcript ID(Array Design) affy.Ce.7521
Sequence Type Exemplar sequence
Representative Public ID ZK520.5 NCBI
Target Description ZK520.5 /REP_DB=WormBase Gene ID /WP=CE16730 /GEN=cyp-7 /TR=O46022 /GB=CAB07303.1 /SUBMIT=HINXTON /CHR=3 /FEA=Sanger Annotation /DEF=Peptidyl-prolyl cis-trans isomerases
Cluster Evidence This cluster is supported by a Sanger Annotation.
Annotation Method Description
Annotation Description This probe set was annotated using the Matching Probes based pipeline to a RefSeq identifier using 1 transcript(s).
Annotation Grade This is a grade A annotation.
Annotation Transcript Cluster (# of Matching Probes) NM_067427(11)
Transcript Assignments
Representative
Transcript
Description Matching Probes Related Probesets by Grade
NM_067427 NCBI Caenorhabditis elegans CYclophyliN family member (cyn-2) (cyn-2) mRNA, complete cds. 11/11 A 
SNAP00000038075 ENSEMBL cdna:SNAP chromosome:CEL140:III:13692248:13693207:1 11/11 None
GENEFINDER00000038080 ENSEMBL cdna:GeneFinder chromosome:CEL140:III:13692248:13693207:1 11/11 None
ZK520.5.2 ENSEMBL cdna:known chromosome:CEL140:III:13692232:13693327:1 gene:ZK520.5 11/11 None
ZK520.5.1 ENSEMBL cdna:known chromosome:CEL140:III:13692232:13693266:1 gene:ZK520.5 11/11 None
Annotation Notes
There are no noteworthy cross hybridizing mRNAs found for this probe set.
Genomic Alignment of Consensus/Exemplar Sequence
Assembly Wormbase March 2004
Alignment(s)
Position Identity Coverage Cytoband
chrIII:13692243-13693203(+) 100.0 100.0
Public Domain and Genome References
Gene Title Peptidyl-prolyl cis-trans isomerases
Gene Symbol cyn-2
Ensembl ZK520.5
Entrez Gene 176807 Entrez gene
SwissProt P52010 EMBL-EBI
WormBase CE16730 Wormbase
Functional Annotations
Ortholog
ID Title Organism
ATGENOME1:18556_AT peptidyl-prolyl cis-trans isomerase / cyclophilin (CYP2) / rotamase at
ATH1-121501:264019_AT peptidyl-prolyl cis-trans isomerase / cyclophilin (CYP2) / rotamase at
CANINE:1582729_S_AT peptidylprolyl isomerase A cfa
CANINE:1597888_AT peptidylprolyl isomerase A cfa
CANINE:1584943_AT peptidylprolyl isomerase A cfa
CANINE_2:CFA.16324.1.S1_S_AT peptidylprolyl isomerase A cfa
CANINE_2:CFA.7255.1.A1_AT Peptidylprolyl isomerase A cfa
CANINE:1593000_AT Peptidylprolyl isomerase A cfa
CANINE:1594275_X_AT Peptidylprolyl isomerase A cfa
CANINE:1594276_S_AT Peptidylprolyl isomerase A cfa
CANINE:1594277_X_AT Peptidylprolyl isomerase A cfa
CANINE:1595775_S_AT Peptidylprolyl isomerase A cfa
CANINE:1584404_AT Peptidylprolyl isomerase A cfa
DROSOPHILA_2:1631760_AT dm
DROSGENOME1:153219_AT dm
DROSOPHILA_2:1639564_A_AT dm
MU11KSUBB:MSA.42241.0_F_AT peptidylprolyl isomerase A mm
MU11KSUBB:MSA.41209.0_F_AT peptidylprolyl isomerase A mm
MU11KSUBB:MSA.38219.0_F_AT peptidylprolyl isomerase A mm
MU11KSUBB:MSA.36304.0_F_AT peptidylprolyl isomerase A mm
MU11KSUBB:X52803_F_AT peptidylprolyl isomerase A mm
MU11KSUBB:MSA.21737.0_F_AT peptidylprolyl isomerase A mm
MU11KSUBB:MSA.25769.0_F_AT peptidylprolyl isomerase A mm
MG-U74AV2:101207_AT peptidylprolyl isomerase A mm
MOE430A:1417451_A_AT peptidylprolyl isomerase A mm
MOUSE430A_2:1417451_A_AT peptidylprolyl isomerase A mm
MOUSE430_2:1417451_A_AT peptidylprolyl isomerase A mm
MU11KSUBB:MSA.16287.0_F_AT Peptidylprolyl isomerase A (Ppia), mRNA mm
MU11KSUBB:MSA.29538.0_F_AT Peptidylprolyl isomerase A (Ppia), mRNA mm
MU19KSUBC:TC39396_F_AT Peptidylprolyl isomerase A (Ppia), mRNA mm
RT-U34:RC_AA818858_S_AT peptidylprolyl isomerase A rn
RG-U34A:RC_AA818858_S_AT peptidylprolyl isomerase A rn
RT-U34:M19533MRNA_I_AT peptidylprolyl isomerase A rn
RG-U34A:M19533MRNA_I_AT peptidylprolyl isomerase A rn
RT-U34:RC_AI228674_S_AT peptidylprolyl isomerase A rn
RG-U34A:RC_AI228674_S_AT peptidylprolyl isomerase A rn
RAE230A:1398850_AT peptidylprolyl isomerase A rn
RAT230_2:1398850_AT peptidylprolyl isomerase A rn
Gene Ontology
GO Biological Process (view graph)
ID Description Evidence Links
6457 protein folding inferred from electronic annotation QuickGO AmiGO
Protein Similarities
Method ID Description E-Value
blast CAB07303 Hypothetical protein ZK520.5 [Caenorhabditis elegans] ref|NP_499828.1| CYclophyliN family member (cyn-2) [Caenorhabditis elegans] sp|P52010|CYP2_CAEEL Peptidyl-prolyl cis-trans isomerase 2 (PPIase) (Rotamase) (Cyclophilin-2) pir||T27882 peptidylprolyl isomerase (EC 5.2.1.8) ZK520.5 [similarity] - Caenorhabditis elegans 2.0E-75
blast AAC47127 cyclophilin isoform 2 (cyp-2) 4.0E-73
Protein Domains
Database ID Description E-Value
Pfam IPR002130 EMBL-EBI Peptidyl-prolyl cis-trans isomerase, cyclophilin type 2.4E-116
Sequence
Target Sequence
>C. ELEGANS:193583_AT
gtgttcttcgatatcacgattggcggaaagaagggaggacgcatcgttatggagctctac
aacgacatcgtgccgaagacagcggaaaacttccgcgctctgtgcaccggcgagaaagga
aaagggaaatcgggcaagaagttgcactttaaaggatccaaatttcatcgcatcatcccc
gagtttatgatccagggcggcgattttacggagggaaacggcaccggcggagaatcgatt
catggcgagaagtttgacgacgagaacttcaaggagaagcataccggacccggagtcttg
tcgatggcaaa


BLASTn GenBank NR
Probe Info
Probe Sequence(5'-3') Probe X Probe Y Probe Interrogation
Position
Strandedness
GTGTTCTTCGATATCACGATTGGCG 678 479 28 Antisense
GGGAGGACGCATCGTTATGGAGCTC 343 495 60 Antisense
AGCTCTACAACGACATCGTGCCGAA 710 79 80 Antisense
GACATCGTGCCGAAGACAGCGGAAA 466 369 91 Antisense
AGCGGAAAACTTCCGCGCTCTGTGC 358 81 108 Antisense
GCTCTGTGCACCGGCGAGAAAGGAA 627 299 124 Antisense
GAAGTTGCACTTTAAAGGATCCAAA 34 337 165 Antisense
ATCGCATCATCCCCGAGTTTATGAT 556 37 194 Antisense
GATCCAGGGCGGCGATTTTACGGAG 664 413 216 Antisense
GAAGCATACCGGACCCGGAGTCTTG 471 339 303 Antisense
GACCCGGAGTCTTGTCGATGGCAAA 66 383 314 Antisense
Sequence Source Affymetrix Proprietary Database