[Home] | [Total List]

[193109_s_at] TGF-beta-like growth factor

Description T25F10.2 /REP_DB=WormBase Gene ID /WP=CE26386 /GEN=dbl-1 /TR=Q23047 /GB=AAB04986.1 /SUBMIT=ST.LOUIS /CHR=5 /FEA=Sanger Annotation /DEF=TGF-beta-like growth factor
Cluster 6grp_total > 14      4grp_total > 38      6grp_cgc > 41      6grp_total_sub > Decrease      

Scale

Warning: fopen(./gnuplot/193109_s_at_1_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/193109_s_at_1_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/193109_s_at_2_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/193109_s_at_2_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252
G range Absolute graph Relative graph Expression Table Dauer Comp.
4 194
1 2 3 4 range
A 296
(3)
P
205.6
(-0.1)
A
123
(-3)
A
219
(0.3)
A
173
B 270.6
(3)
P
174.7
(-0.4)
A
102.1
(-3)
A
179.5
(-0.2)
P
169
C 275.7
(3)
P
197.8
(-0.4)
A
136.5
(-3)
A
217.5
(0.5)
P
139
avr 280.8
(3)
192.7
(-0.3)
120.5
(-3)
205.3
(0.2)
160

Warning: fopen(./gnuplot/193109_s_at_dSignal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/193109_s_at_dSignal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

1 : 1 state (S1, L1)
2 : dauer (ST, LT)
6 212
1 2 3 4 5 6 range
A 179
(1.8)
P
200.1
(3)
P
104.1
(-2.3)
A
139.3
(-0.3)
A
108.1
(-2)
A
90.7
(-3)
A
109
B 140.5
(3)
P
125.5
(1.8)
P
135.8
(2.6)
A
101.4
(-0.1)
A
84.7
(-1.5)
A
65.9
(-3)
A
75
C 271.3
(3)
P
218.5
(1.5)
P
151
(-0.4)
A
166.8
(0)
A
114.2
(-1.4)
A
59.3
(-3)
A
212
avr 196.9
(3)
181.4
(2.3)
130.3
(-0.2)
135.8
(0.1)
102.3
(-1.5)
72
(-3)
125
No Scale

Warning: fopen(./gnuplot/193109_s_at_1_No_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/193109_s_at_1_No_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/193109_s_at_2_No_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/193109_s_at_2_No_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252
G range Absolute graph Relative graph Expression Table Dauer Comp.
4 84
1 2 3 4 range
A 107.8
(3)
P
44.6
(-2)
A
32.2
(-3)
A
32.1
(-3)
A
76
B 86.3
(3)
P
43.1
(-1.1)
A
23.7
(-3)
A
38.3
(-1.6)
P
63
C 91.3
(3)
P
56.9
(-0.8)
A
47.6
(-1.8)
A
36.7
(-3)
P
55
avr 95.1
(3)
48.2
(-1.6)
34.5
(-3)
35.7
(-2.9)
61

Warning: fopen(./gnuplot/193109_s_at_dNo_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/193109_s_at_dNo_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

1 : 1 state (S1, L1)
2 : dauer (ST, LT)
6 81
1 2 3 4 5 6 range
A 33
(-1.7)
P
71.2
(3)
P
22.7
(-2.9)
A
35.3
(-1.4)
A
32.6
(-1.7)
A
22.1
(-3)
A
49
B 48.9
(3)
P
41.8
(1.2)
P
33
(-0.9)
A
26.9
(-2.4)
A
34.4
(-0.6)
A
24.6
(-3)
A
24
C 100.5
(3)
P
66.7
(0.5)
P
38.4
(-1.6)
A
33.5
(-2)
A
36.9
(-1.7)
A
19.9
(-3)
A
81
avr 60.8
(3)
59.9
(2.9)
31.4
(-1.6)
31.9
(-1.5)
34.6
(-1.1)
22.2
(-3)
39
NetAffx Links Cluster Members
Consensus/Exemplar
Group Members
GeneChip Array Information
Probe Set ID 193109_s_at
GeneChip Array C. elegans Genome Array
Organism Common Name Nematode
Probe Design Information
Transcript ID(Array Design) affy.Ce.11329
Sequence Type Exemplar sequence
Representative Public ID T25F10.2 NCBI
Target Description T25F10.2 /REP_DB=WormBase Gene ID /WP=CE26386 /GEN=dbl-1 /TR=Q23047 /GB=AAB04986.1 /SUBMIT=ST.LOUIS /CHR=5 /FEA=Sanger Annotation /DEF=TGF-beta-like growth factor
Cluster Evidence This cluster is supported by a Sanger Annotation.
Annotation Method Description
Annotation Description This probe set was annotated using the Matching Probes based pipeline to a RefSeq identifier using 1 transcript(s).
Annotation Grade This is a grade A annotation.
Annotation Transcript Cluster (# of Matching Probes) NM_072308(11)
Transcript Assignments
Representative
Transcript
Description Matching Probes Related Probesets by Grade
NM_072308 NCBI Caenorhabditis elegans DPP/BMP-Like family member (dbl-1) (dbl-1) mRNA, complete cds. 11/11 A 
SNAP00000017678 ENSEMBL cdna:SNAP chromosome:CEL140:V:6760879:6762430:1 11/11 None
GENEFINDER00000017685 ENSEMBL cdna:GeneFinder chromosome:CEL140:V:6760879:6762533:1 11/11 None
T25F10.2.2 ENSEMBL cdna:known chromosome:CEL140:V:6760723:6763010:1 gene:T25F10.2 11/11 None
T25F10.2.1 ENSEMBL cdna:known chromosome:CEL140:V:6760729:6763003:1 gene:T25F10.2 11/11 None
Annotation Notes
There are no noteworthy cross hybridizing mRNAs found for this probe set.
Genomic Alignment of Consensus/Exemplar Sequence
Assembly Wormbase March 2004
Alignment(s)
Position Identity Coverage Cytoband
chrV:6760879-6762534(+) 100.0 100.0
Public Domain and Genome References
Gene Title TGF-beta-like growth factor
Gene Symbol dbl-1
Ensembl T25F10.2
Entrez Gene 179068 Entrez gene
SwissProt O02424 EMBL-EBI
WormBase CE26386 Wormbase
Functional Annotations
Ortholog
ID Title Organism
CANINE:1604541_AT similar to Bone morphogenetic protein 5 precursor (BMP-5) cfa
CANINE_2:CFAAFFX.4373.1.S1_S_AT similar to Bone morphogenetic protein 5 precursor (BMP-5) cfa
CHICKEN:GGA.620.1.S1_AT bone morphogenetic protein 5 gga
HG-U95AV2:1831_AT bone morphogenetic protein 5 hs
HC-G110:1831_AT bone morphogenetic protein 5 hs
HG-U95AV2:200_AT bone morphogenetic protein 5 hs
HC-G110:200_AT bone morphogenetic protein 5 hs
HG-U133_PLUS_2:205431_S_AT bone morphogenetic protein 5 hs
HG-U133A:205431_S_AT bone morphogenetic protein 5 hs
HG-FOCUS:205431_S_AT bone morphogenetic protein 5 hs
HG-U133A_2:205431_S_AT bone morphogenetic protein 5 hs
HUGENEFL:S81957_AT bone morphogenetic protein 5 hs
HUGENEFL:M60314_AT bone morphogenetic protein 5 hs
U133_X3P:G10835090_3P_A_AT bone morphogenetic protein 5 hs
U133_X3P:HS.1104.0.S2_3P_AT bone morphogenetic protein 5 hs
HG-U133A_2:205430_AT bone morphogenetic protein 5 hs
HG-U133_PLUS_2:205430_AT bone morphogenetic protein 5 hs
HG-U133A:205430_AT bone morphogenetic protein 5 hs
HG-U133_PLUS_2:233606_AT Bone morphogenetic protein 5 hs
HG-U133B:233606_AT Bone morphogenetic protein 5 hs
U133_X3P:HS.296648.0.S1_3P_AT Bone morphogenetic protein 5 hs
HG-U95C:53804_AT Bone morphogenetic protein 5 hs
HU35KSUBC:RC_R23252_AT Bone morphogenetic protein 5 hs
MOE430A:1421283_AT bone morphogenetic protein 5 mm
MOUSE430A_2:1421283_AT bone morphogenetic protein 5 mm
MOUSE430_2:1421283_AT bone morphogenetic protein 5 mm
MU11KSUBB:MSA.1463.0_S_AT bone morphogenetic protein 5 mm
MG-U74AV2:99393_AT bone morphogenetic protein 5 mm
MG-U74BV2:163125_AT bone morphogenetic protein 5 mm
MOE430A:1421282_AT bone morphogenetic protein 5 mm
MOUSE430A_2:1421282_AT bone morphogenetic protein 5 mm
MOUSE430_2:1421282_AT bone morphogenetic protein 5 mm
MOE430B:1455851_AT bone morphogenetic protein 5 mm
MOUSE430_2:1455851_AT bone morphogenetic protein 5 mm
MU19KSUBC:TC38150_AT Bone morphogenetic protein 5 (Bmp5), mRNA mm
RG-U34B:RC_AA946142_AT bone morphogenetic protein 5 (predicted) rn
RAE230B:1382657_AT bone morphogenetic protein 5 (predicted) rn
RAT230_2:1382657_AT bone morphogenetic protein 5 (predicted) rn
Gene Ontology
GO Biological Process (view graph)
ID Description Evidence Links
40007 growth inferred from electronic annotation QuickGO AmiGO
GO Molecular Function (view graph)
ID Description Evidence Links
8083 growth factor activity inferred from electronic annotation QuickGO AmiGO
Protein Similarities
Method ID Description E-Value
blast AAB04986 Dpp/bmp-like protein 1 [Caenorhabditis elegans] ref|NP_504709.1| DPP/BMP-Like family member (dbl-1) [Caenorhabditis elegans] gb|AAC27729.1| decapentaplegic protein homolog [Caenorhabditis elegans] 0.0
blast AAC26791 CET-1 [Caenorhabditis elegans] 0.0
blast AAB04986 Dpp/bmp-like protein 1 [Caenorhabditis elegans] ref|NP_504709.1| DPP/BMP-Like family member (dbl-1) [Caenorhabditis elegans] gb|AAC27729.1| decapentaplegic protein homolog [Caenorhabditis elegans] 1.0E-167
blast AAC26791 CET-1 [Caenorhabditis elegans] 1.0E-163
Protein Domains
Database ID Description E-Value
Pfam IPR001839 EMBL-EBI Transforming growth factor beta 1.5E-52
Pfam IPR001839 EMBL-EBI Transforming growth factor beta 2.8E-41
Trans Membrane
ID Number Of Domains Domain Boundaries
NP_504709.1 1 20-42
T25F10.2.2 1 20-42
T25F10.2.1 1 20-42
SNAP00000017678 1 20-42
GENEFINDER00000017685 1 20-42
Sequence
Target Sequence
>C. ELEGANS:193109_S_AT
aatcgaatctcgatccgtcgacaaccttaccgaatggatcgattttgatgtgaccgccgc
ttttttgcggcgaacaaatcgtatcagtttcttcatcgatttgccggaagatgtggagat
cgaagagacacagagcagctcactgagctcattgccctacgcgcgggctcagagtgctcc
gcttattgtgttcagtgacctgtccgaaccgtccagtgtgcggcggaaacggagtgcaca
aacaggcaacagcgaacgaaaaaatcgaaaaaagggtagaaagcatcataacaccgaggc
cgagagcaatctttgtcggaggactgatttctacgtggattttgatgatttaaattggca
agactggattatggcacccaagggctacgatgcttatcaatgtcaaggctcttgtccaaa
tccaatgccagctcagttaaatgcaactaatcacgctattattcaatcacttttacactc
tttgagacctgatgaagtaccgccaccttgctgtgtgcctactgaaacgagccctctttc
gatt


BLASTn GenBank NR
Probe Info
Probe Sequence(5'-3') Probe X Probe Y Probe Interrogation
Position
Strandedness
AATCGAATCTCGATCCGTCGACAAC 536 167 489 Antisense
GTGACCGCCGCTTTTTTGCGGCGAA 569 481 538 Antisense
TCAGTTTCTTCATCGATTTGCCGGA 42 623 572 Antisense
AGCAGCTCACTGAGCTCATTGCCCT 622 77 622 Antisense
TCAGAGTGCTCCGCTTATTGTGTTC 42 625 657 Antisense
TGTGTTCAGTGACCTGTCCGAACCG 425 555 675 Antisense
GAAAGCATCATAACACCGAGGCCGA 26 361 767 Antisense
GTCGGAGGACTGATTTCTACGTGGA 153 473 803 Antisense
ATGGCACCCAAGGGCTACGATGCTT 199 53 859 Antisense
ACCTTGCTGTGTGCCTACTGAAACG 144 87 993 Antisense
TACTGAAACGAGCCCTCTTTCGATT 480 647 1008 Antisense
Sequence Source Affymetrix Proprietary Database