[Home] | [Total List]

[192955_at] Zinc finger, C3HC4 type (RING finger)

Description Y38H8A.2 /REP_DB=WormBase Gene ID /WP=CE18364 /TR=O62427 /GB=CAA16346.1 /SUBMIT=HINXTON /CHR=4 /FEA=Sanger Annotation /DEF=Zinc finger, C3HC4 type (RING finger)
Cluster 6grp_total > 99      4grp_total > 08      6grp_total_sub > Increase      6grp_rule_based > S6      

Scale

Warning: fopen(./gnuplot/192955_at_1_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/192955_at_1_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/192955_at_2_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/192955_at_2_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252
G range Absolute graph Relative graph Expression Table Dauer Comp.
4 100
1 2 3 4 range
A 6.5
(3)
A
5
(0)
A
3.5
(-3)
A
4
(-2)
A
3
B 3.7
(-2.9)
A
3.6
(-3)
A
5.3
(-2)
A
14.1
(3)
A
11
C 7.2
(-3)
A
8.1
(-2.9)
A
40.1
(-1)
A
103.7
(3)
A
97
avr 5.8
(-3)
5.6
(-3)
16.3
(-1.2)
40.6
(3)
35

Warning: fopen(./gnuplot/192955_at_dSignal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/192955_at_dSignal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

1 : 1 state (S1, L1)
2 : dauer (ST, LT)
6 29
1 2 3 4 5 6 range
A 7.5
(-1.9)
A
4.5
(-2.8)
A
8.4
(-1.7)
A
3.9
(-3)
A
5.7
(-2.5)
A
24.3
(3)
A
20
B 3
(-3)
A
3.1
(-3)
A
4.7
(-2.6)
A
3.7
(-2.9)
A
31.9
(3)
A
28.7
(2.3)
A
29
C 4.4
(-2.9)
A
8.2
(-1.7)
A
8.2
(-1.7)
A
4.1
(-3)
A
22.6
(3)
A
21.8
(2.7)
A
19
avr 5
(-2.7)
5.3
(-2.6)
7.1
(-2.1)
3.9
(-3)
20.1
(1.6)
24.9
(3)
21
No Scale

Warning: fopen(./gnuplot/192955_at_1_No_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/192955_at_1_No_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/192955_at_2_No_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/192955_at_2_No_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252
G range Absolute graph Relative graph Expression Table Dauer Comp.
4 17
1 2 3 4 range
A 2.4
(3)
A
1.1
(-1.3)
A
0.9
(-2)
A
0.6
(-3)
A
2
B 1.2
(-2.1)
A
0.9
(-3)
A
1.2
(-2.1)
A
3
(3)
A
2
C 2.4
(-3)
A
2.3
(-3)
A
14
(1.6)
A
17.5
(3)
A
15
avr 2
(-2.4)
1.4
(-3)
5.4
(1.3)
7
(3)
6

Warning: fopen(./gnuplot/192955_at_dNo_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/192955_at_dNo_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

1 : 1 state (S1, L1)
2 : dauer (ST, LT)
6 12
1 2 3 4 5 6 range
A 1.4
(-2.5)
A
1.6
(-2.3)
A
1.8
(-2)
A
1
(-3)
A
1.7
(-2.1)
A
5.9
(3)
A
5
B 1
(-3)
A
1
(-3)
A
1.1
(-3)
A
1
(-3)
A
13
(3)
A
10.7
(1.8)
A
12
C 1.6
(-2.3)
A
2.5
(-1.4)
A
2.1
(-1.8)
A
0.8
(-3)
A
7.3
(3)
A
7.3
(3)
A
7
avr 1.3
(-2.7)
1.7
(-2.3)
1.7
(-2.3)
0.9
(-3)
7.3
(2.4)
8
(3)
7
NetAffx Links Cluster Members
Consensus/Exemplar
GeneChip Array Information
Probe Set ID 192955_at
GeneChip Array C. elegans Genome Array
Organism Common Name Nematode
Probe Design Information
Transcript ID(Array Design) affy.Ce.8869
Sequence Type Exemplar sequence
Representative Public ID Y38H8A.2 NCBI
Target Description Y38H8A.2 /REP_DB=WormBase Gene ID /WP=CE18364 /TR=O62427 /GB=CAA16346.1 /SUBMIT=HINXTON /CHR=4 /FEA=Sanger Annotation /DEF=Zinc finger, C3HC4 type (RING finger)
Cluster Evidence This cluster is supported by a Sanger Annotation.
Annotation Method Description
Annotation Description This probe set was annotated using the Matching Probes based pipeline to a RefSeq identifier using 1 transcript(s).
Annotation Grade This is a grade A annotation.
Annotation Transcript Cluster (# of Matching Probes) NM_070196(11)
Transcript Assignments
Representative
Transcript
Description Matching Probes Related Probesets by Grade
NM_070196 NCBI Caenorhabditis elegans Y38H8A.2 (Y38H8A.2) mRNA, complete cds. 11/11 None
SNAP00000011905 ENSEMBL cdna:SNAP chromosome:CEL140:IV:13474401:13476186:1 11/11 None
GENEFINDER00000011914 ENSEMBL cdna:GeneFinder chromosome:CEL140:IV:13474401:13476186:1 11/11 None
Y38H8A.2 ENSEMBL cdna:known chromosome:CEL140:IV:13474401:13476186:1 gene:Y38H8A.2 11/11 None
Annotation Notes
There are no noteworthy cross hybridizing mRNAs found for this probe set.
Genomic Alignment of Consensus/Exemplar Sequence
Assembly Wormbase March 2004
Alignment(s)
Position Identity Coverage Cytoband
chrIV:13474406-13476192(+) 100.0 100.0
Public Domain and Genome References
Gene Title Zinc finger, C3HC4 type (RING finger)
Ensembl Y38H8A.2
Entrez Gene 189703 Entrez gene
SwissProt O62427 EMBL-EBI
WormBase CE18364 Wormbase
Functional Annotations
Protein Similarities
Method ID Description E-Value
blast CAA16346 Hypothetical protein Y38H8A.2 [Caenorhabditis elegans] ref|NP_502597.1| Y38H8A.2 [Caenorhabditis elegans] 1.0E-149
blast CAA16346 Hypothetical protein Y38H8A.2 [Caenorhabditis elegans] ref|NP_502597.1| Y38H8A.2 [Caenorhabditis elegans] 1.0E-143
Sequence
Target Sequence
>C. ELEGANS:192955_AT
gggtgatgctcttggaatcagccatcgatgtgatgagtgtgatgagatgatgaagtttga
aacgtgggtggaaagacaggatgcaatattggaatgtggtcatgggtactgtaagaagtg
cataccaaatattaagaaagatgcccacaccttgacaaagtgtccggtagttgcagtgaa
atgtcgaattccaaattggtatcagactggacaagcagcgaaaccatcgcatcgaaaaag
tgaagctgcacggaaggagtactctactaaagcaaaattatggaatttcgaatataaagg
acgtccactggtggtttctcttcgtcgtgatgctacttatggagacctggaaacaagcct
atccatgttgctaaacatcgatctgaaaaccaacatgattctaattcatcttccacactc
atacaatggagcagatgtcaattatttcatgaaagccgacgattcgcttacaaatggtcc
atatgaaaaagatacaaagctgagtcatctacgtcatccgaaaattgcagctttgagtct
ggaagtgactgaaaagaagacaccgagctctgagactcc


BLASTn GenBank NR
Probe Info
Probe Sequence(5'-3') Probe X Probe Y Probe Interrogation
Position
Strandedness
GGGTGATGCTCTTGGAATCAGCCAT 49 497 153 Antisense
TAAGAAAGATGCCCACACCTTGACA 16 639 285 Antisense
AGCTGCACGGAAGGAGTACTCTACT 401 79 396 Antisense
AGGACGTCCACTGGTGGTTTCTCTT 406 55 450 Antisense
TTTCTCTTCGTCGTGATGCTACTTA 285 671 467 Antisense
ACAAGCCTATCCATGTTGCTAAACA 312 111 505 Antisense
TTCATCTTCCACACTCATACAATGG 204 689 557 Antisense
CGACGATTCGCTTACAAATGGTCCA 181 251 609 Antisense
CAAAGCTGAGTCATCTACGTCATCC 11 193 647 Antisense
ACGTCATCCGAAAATTGCAGCTTTG 566 91 663 Antisense
AGAAGACACCGAGCTCTGAGACTCC 575 73 707 Antisense
Sequence Source Affymetrix Proprietary Database