[Home] | [Total List]

[192943_at] 3-oxo-5-alpha-steroid 4-dehydrogenase

Description ZK1251.3 /REP_DB=WormBase Gene ID /WP=CE03850 /TR=Q23431 /GB=CAA92499.1 /SUBMIT=HINXTON /CHR=4 /FEA=Sanger Annotation /DEF=3-oxo-5-alpha-steroid 4-dehydrogenase
Cluster 6grp_total > 95      4grp_total > 0      6grp_total_sub > Increase      6grp_rule_based > S5      

Scale

Warning: fopen(./gnuplot/192943_at_1_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/192943_at_1_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/192943_at_2_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/192943_at_2_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252
G range Absolute graph Relative graph Expression Table Dauer Comp.
4 90
1 2 3 4 range
A 8.7
(-1.5)
A
17
(0.5)
A
2.3
(-3)
A
27.6
(3)
A
25
B 47
(3)
A
6.4
(-3)
A
46.6
(2.9)
A
9.1
(-2.6)
A
41
C 3.7
(-3)
A
13.3
(-2.4)
A
17.1
(-2.1)
A
92.7
(3)
A
89
avr 19.8
(-1.5)
12.2
(-3)
22
(-1.1)
43.1
(3)
31

Warning: fopen(./gnuplot/192943_at_dSignal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/192943_at_dSignal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

1 : 1 state (S1, L1)
2 : dauer (ST, LT)
6 104
1 2 3 4 5 6 range
A 56.2
(0.1)
A
2.1
(-3)
A
59.9
(0.3)
P
16
(-2.2)
A
106
(3)
P
101.4
(2.7)
P
104
B 29.5
(-2.5)
A
39
(-1.4)
A
24.7
(-3)
A
61.2
(1)
P
66.6
(1.6)
P
79
(3)
P
54
C 15.1
(-2.1)
A
56.3
(0.8)
A
3.1
(-3)
A
67.9
(1.7)
A
86.5
(3)
P
72.1
(2)
P
83
avr 33.6
(-2.5)
32.5
(-2.7)
29.2
(-3)
48.4
(-1)
86.4
(3)
84.2
(2.8)
57
No Scale

Warning: fopen(./gnuplot/192943_at_1_No_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/192943_at_1_No_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/192943_at_2_No_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/192943_at_2_No_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252
G range Absolute graph Relative graph Expression Table Dauer Comp.
4 15
1 2 3 4 range
A 3.2
(1.6)
A
3.7
(2.5)
A
0.6
(-3)
A
4
(3)
A
3
B 15
(3)
A
1.6
(-3)
A
10.8
(1.1)
A
1.9
(-2.9)
A
13
C 1.2
(-3)
A
3.8
(-1.9)
A
6
(-1)
A
15.6
(3)
A
14
avr 6.5
(2)
3
(-3)
5.8
(1)
7.2
(3)
4

Warning: fopen(./gnuplot/192943_at_dNo_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/192943_at_dNo_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

1 : 1 state (S1, L1)
2 : dauer (ST, LT)
6 31
1 2 3 4 5 6 range
A 10.4
(-1.1)
A
0.7
(-3)
A
13.1
(-0.6)
P
4.1
(-2.3)
A
32
(3)
P
24.7
(1.6)
P
31
B 10.2
(-1.9)
A
13
(-1.2)
A
6
(-3)
A
16.2
(-0.4)
P
27
(2.4)
P
29.5
(3)
P
24
C 5.6
(-1.9)
A
17.2
(0.6)
A
0.8
(-3)
A
13.7
(-0.2)
A
28
(3)
P
24.1
(2.1)
P
27
avr 8.7
(-2.4)
10.3
(-2)
6.6
(-3)
11.3
(-1.7)
29
(3)
26.1
(2.2)
22
NetAffx Links Cluster Members
Consensus/Exemplar
GeneChip Array Information
Probe Set ID 192943_at
GeneChip Array C. elegans Genome Array
Organism Common Name Nematode
Probe Design Information
Transcript ID(Array Design) affy.Ce.9070
Sequence Type Exemplar sequence
Representative Public ID ZK1251.3 NCBI
Target Description ZK1251.3 /REP_DB=WormBase Gene ID /WP=CE03850 /TR=Q23431 /GB=CAA92499.1 /SUBMIT=HINXTON /CHR=4 /FEA=Sanger Annotation /DEF=3-oxo-5-alpha-steroid 4-dehydrogenase
Cluster Evidence This cluster is supported by a Sanger Annotation.
Annotation Method Description
Annotation Description This probe set was annotated using the Matching Probes based pipeline to a RefSeq identifier using 1 transcript(s).
Annotation Grade This is a grade A annotation.
Annotation Transcript Cluster (# of Matching Probes) NM_069318(11)
Transcript Assignments
Representative
Transcript
Description Matching Probes Related Probesets by Grade
NM_069318 NCBI Caenorhabditis elegans ZK1251.3 (ZK1251.3) mRNA, complete cds. 11/11 None
SNAP00000023382 ENSEMBL cdna:SNAP chromosome:CEL140:IV:9683641:9684450:1 11/11 None
GENEFINDER00000023390 ENSEMBL cdna:GeneFinder chromosome:CEL140:IV:9683641:9684450:1 11/11 None
ZK1251.3 ENSEMBL cdna:known chromosome:CEL140:IV:9683641:9684450:1 gene:ZK1251.3 11/11 None
Annotation Notes
There are no noteworthy cross hybridizing mRNAs found for this probe set.
Genomic Alignment of Consensus/Exemplar Sequence
Assembly Wormbase March 2004
Alignment(s)
Position Identity Coverage Cytoband
chrIV:9683646-9684456(+) 100.0 100.0
Public Domain and Genome References
Gene Title 3-oxo-5-alpha-steroid 4-dehydrogenase
Ensembl ZK1251.3
Entrez Gene 191550 Entrez gene
SwissProt Q23431 EMBL-EBI
WormBase CE03850 Wormbase
Functional Annotations
Gene Ontology
GO Cellular Component (view graph)
ID Description Evidence Links
16021 integral to membrane inferred from electronic annotation QuickGO AmiGO
Protein Similarities
Method ID Description E-Value
blast CAA92499 Hypothetical protein ZK1251.3 [Caenorhabditis elegans] ref|NP_501719.1| ZK1251.3 [Caenorhabditis elegans] 1.0E-153
blast CAE67002 Hypothetical protein CBG12401 [Caenorhabditis briggsae] 1.0E-108
blast CAA92173 Hypothetical protein F42F12.3 [Caenorhabditis elegans] ref|NP_510071.1| F42F12.3 [Caenorhabditis elegans] 5.0E-48
Protein Domains
Database ID Description E-Value
Pfam IPR001104 EMBL-EBI 3-oxo-5-alpha-steroid 4-dehydrogenase, C-terminal 3.7E-98
Trans Membrane
ID Number Of Domains Domain Boundaries
NP_501719.1 6 2-24,48-70,77-99,109-131,144-166,200-222
ZK1251.3 6 2-24,48-70,77-99,109-131,144-166,200-222
SNAP00000023382 6 2-24,48-70,77-99,109-131,144-166,200-222
GENEFINDER00000023390 6 2-24,48-70,77-99,109-131,144-166,200-222
Sequence
Target Sequence
>C. ELEGANS:192943_AT
tgacttttcactatgcctatcgttcatttgtctatccattcattatcaactcggataatc
agagtcccgtcaaaatagtgataatggcttttggattctctgtgttaaatggatttattc
aaggaacgtggaatgcattttatcaacccgaattcgatacactacatcctaaatttttcg
tatttcttggggcttggctgttcgtgattggattcataactcattgcgtttctgatcttc
atctcatcactcttcgcaatgattacctgaatagttacagtattccacggggacactatt
tcgaatacatttcttgtccaaattattttggtgaatgcttgcaatggatcggttatgcac
tggctgctcgtagttttccggcaattgccttcgcattcttcattgtttgcaatctggctc
cacgagcaatgtcacatca


BLASTn GenBank NR
Probe Info
Probe Sequence(5'-3') Probe X Probe Y Probe Interrogation
Position
Strandedness
TGACTTTTCACTATGCCTATCGTTC 306 567 263 Antisense
TGCCTATCGTTCATTTGTCTATCCA 81 585 276 Antisense
TGTCTATCCATTCATTATCAACTCG 455 557 291 Antisense
AATGGCTTTTGGATTCTCTGTGTTA 155 163 345 Antisense
ACCCGAATTCGATACACTACATCCT 93 89 408 Antisense
TATTTCTTGGGGCTTGGCTGTTCGT 394 661 443 Antisense
ACTCATTGCGTTTCTGATCTTCATC 271 101 481 Antisense
TTCATCTCATCACTCTTCGCAATGA 301 689 500 Antisense
GTATTCCACGGGGACACTATTTCGA 663 451 542 Antisense
GTAGTTTTCCGGCAATTGCCTTCGC 590 447 632 Antisense
TGGCTCCACGAGCAATGTCACATCA 575 543 677 Antisense
Sequence Source Affymetrix Proprietary Database