[Home] | [Total List]

[192570_s_at] recombiation protein

Description ZK1127.11 /REP_DB=WormBase Gene ID /WP=CE24714 /GEN=him-14 /TR=Q23405 /GB=AAB93433.2 /SUBMIT=ST.LOUIS /CHR=2 /FEA=Sanger Annotation /DEF=recombiation protein
Cluster 6grp_total > 96      4grp_total > 0      6grp_cgc > 68      6grp_cgc_sub > In      6grp_total_sub > Increase      6grp_rule_based > S6      

Scale

Warning: fopen(./gnuplot/192570_s_at_1_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/192570_s_at_1_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/192570_s_at_2_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/192570_s_at_2_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252
G range Absolute graph Relative graph Expression Table Dauer Comp.
4 64
1 2 3 4 range
A 4.4
(-3)
A
9.7
(-2.5)
A
16.9
(-1.8)
A
67.8
(3)
A
63
B 34
(0.2)
A
4.5
(-3)
A
4.4
(-3)
A
60
(3)
A
56
C 6.3
(-2.8)
A
4.5
(-3)
A
68.5
(3)
A
34.9
(-0.2)
A
64
avr 14.9
(-1.9)
6.2
(-3)
29.9
(-0)
54.2
(3)
48

Warning: fopen(./gnuplot/192570_s_at_dSignal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/192570_s_at_dSignal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

1 : 1 state (S1, L1)
2 : dauer (ST, LT)
6 283
1 2 3 4 5 6 range
A 37.5
(-2)
A
4.9
(-3)
A
35.5
(-2)
M
85.7
(-0.4)
P
130.1
(1)
P
194.1
(3)
P
189
B 17.6
(-3)
A
25.4
(-2.7)
A
49.5
(-1.9)
A
88.1
(-0.5)
P
120.9
(0.7)
P
184.6
(3)
P
167
C 10.9
(-3)
A
22.9
(-2.7)
A
38.9
(-2.4)
A
74.9
(-1.6)
A
139.2
(-0.2)
P
288
(3)
P
277
avr 22
(-2.9)
17.7
(-3)
41.3
(-2.3)
82.9
(-1.1)
130.1
(0.3)
222.2
(3)
205
No Scale

Warning: fopen(./gnuplot/192570_s_at_1_No_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/192570_s_at_1_No_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/192570_s_at_2_No_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/192570_s_at_2_No_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252
G range Absolute graph Relative graph Expression Table Dauer Comp.
4 23
1 2 3 4 range
A 1.6
(-3)
A
2.1
(-2.6)
A
4.4
(-1)
A
9.9
(3)
A
8
B 10.9
(2)
A
1.1
(-2.9)
A
1
(-3)
A
12.8
(3)
A
12
C 2.1
(-2.8)
A
1.3
(-3)
A
23.9
(3)
A
5.9
(-1.8)
A
23
avr 4.9
(-0.5)
1.5
(-3)
9.8
(3)
9.5
(2.8)
8

Warning: fopen(./gnuplot/192570_s_at_dNo_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/192570_s_at_dNo_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

1 : 1 state (S1, L1)
2 : dauer (ST, LT)
6 95
1 2 3 4 5 6 range
A 6.9
(-2.3)
A
1.7
(-3)
A
7.7
(-2.2)
M
21.7
(-0.4)
P
39.3
(2)
P
47.2
(3)
P
46
B 6.1
(-3)
A
8.5
(-2.8)
A
12
(-2.4)
A
23.3
(-1.4)
P
49.1
(1.1)
P
68.8
(3)
P
63
C 4
(-3)
A
7
(-2.8)
A
9.9
(-2.6)
A
15.1
(-2.3)
A
45
(-0.3)
P
96.4
(3)
P
92
avr 5.7
(-3)
5.7
(-3)
9.9
(-2.6)
20
(-1.7)
44.5
(0.6)
70.8
(3)
65
NetAffx Links Cluster Members
Consensus/Exemplar
Group Members
GeneChip Array Information
Probe Set ID 192570_s_at
GeneChip Array C. elegans Genome Array
Organism Common Name Nematode
Probe Design Information
Transcript ID(Array Design) affy.Ce.4377
Sequence Type Exemplar sequence
Representative Public ID ZK1127.11 NCBI
Target Description ZK1127.11 /REP_DB=WormBase Gene ID /WP=CE24714 /GEN=him-14 /TR=Q23405 /GB=AAB93433.2 /SUBMIT=ST.LOUIS /CHR=2 /FEA=Sanger Annotation /DEF=recombiation protein
Cluster Evidence This cluster is supported by a Sanger Annotation.
Annotation Method Description
Annotation Description This probe set was annotated using the Matching Probes based pipeline to a RefSeq identifier using 1 transcript(s).
Annotation Grade This is a grade A annotation.
Annotation Transcript Cluster (# of Matching Probes) NM_063050(11)
Transcript Assignments
Representative
Transcript
Description Matching Probes Related Probesets by Grade
NM_063050 NCBI Caenorhabditis elegans High Incidence of Males (increased X chromosome loss) family member (him-14) (him-14) mRNA, complete cds. 11/11 A 
ZK1127.11 ENSEMBL cdna:known chromosome:CEL140:II:7064985:7069896:-1 gene:ZK1127.11 11/11 A 
Annotation Notes
Cross Hybridizing mRNA Matched Probes Nature of Assignment Related Probesets by Grade
GENEFINDER00000033604 8/11 Cross Hyb Matching Probes None
Genomic Alignment of Consensus/Exemplar Sequence
Assembly Wormbase March 2004
Alignment(s)
Position Identity Coverage Cytoband
chrII:7065043-7069892(-) 100.0 100.0
Public Domain and Genome References
Gene Title recombiation protein
Gene Symbol him-14
Ensembl ZK1127.11
Entrez Gene 174157 Entrez gene
SwissProt Q23405 EMBL-EBI
WormBase CE24714 Wormbase
Functional Annotations
Ortholog
ID Title Organism
ATGENOME1:17491_AT DNA mismatch repair MutS family protein at
ATH1-121501:245419_AT DNA mismatch repair MutS family protein at
CANINE_2:CFAAFFX.31219.1.S1_AT similar to MutS protein homolog 4 cfa
HG-U133_PLUS_2:210533_AT mutS homolog 4 (E. coli) hs
HG-U133A:210533_AT mutS homolog 4 (E. coli) hs
HG-FOCUS:210533_AT mutS homolog 4 (E. coli) hs
HG-U133A_2:210533_AT mutS homolog 4 (E. coli) hs
HG-U95AV2:31714_AT mutS homolog 4 (E. coli) hs
U133_X3P:G4336727_3P_AT mutS homolog 4 (E. coli) hs
MOUSE430_2:1419511_AT mutS homolog 4 (E. coli) mm
MOE430A:1419511_AT mutS homolog 4 (E. coli) mm
MOUSE430A_2:1419511_AT mutS homolog 4 (E. coli) mm
MG-U74CV2:165550_AT mutS homolog 4 (E. coli) mm
YEAST_2:1776312_AT Protein involved in meiotic recombination, required for normal levels of crossing over, colocalizes with Zip2p to discrete foci on meiotic chromosomes, has homology to bacterial MutS protein Sc
Gene Ontology
GO Biological Process (view graph)
ID Description Evidence Links
6259 DNA metabolism inferred from electronic annotation QuickGO AmiGO
6298 mismatch repair inferred from electronic annotation QuickGO AmiGO
GO Molecular Function (view graph)
ID Description Evidence Links
3684 damaged DNA binding inferred from electronic annotation QuickGO AmiGO
5524 ATP binding inferred from electronic annotation QuickGO AmiGO
Protein Similarities
Method ID Description E-Value
blast AAB93433 High incidence of males (increased x chromosome loss) protein 14 [Caenorhabditis elegans] ref|NP_495451.1| High Incidence of Males (increased X chromosome loss) family member (him-14) [Caenorhabditis elegans] gb|AAD52669.1| HIM-14 protein [Caenorhabditis elegans] sp|Q23405|HIM14_CAEEL MUTS protein homolog him-14 0.0
blast E88197 protein him-14 [imported] - Caenorhabditis elegans 0.0
blast CAE56902 Hypothetical protein CBG24743 [Caenorhabditis briggsae] 0.0
Protein Domains
Database ID Description E-Value
Pfam IPR007861 EMBL-EBI MutS IV 6.0E-16
Pfam IPR007696 EMBL-EBI MutS III 1.6E-16
Pfam IPR000432 EMBL-EBI DNA mismatch repair protein MutS, C-terminal 1.7E-70
Sequence
Target Sequence
>C. ELEGANS:192570_S_AT
gaagcacgtcgactgaagaaggcatcgccatcacctatgcgatttgtgagaaagttctaa
agttacagagctataccttcctggctacacattttctcgatattgcggctctcgccaact
attcaaatgcaattgacaattatcactttcttccacaaactgatgaaaattcgacgaaaa
agcacaagttgttacgtggacaatatagaggaccattatacggtttcgagctggttgaac
tctcaacaattcccgatgaagttatcgagcatgctcaatcactagcaaccgaacttagag
caaatgtcgaggacacggagcgagactatgactcagaacgccgtaggatcaaagtctaca
tgaaccatcgtttcagagaatgtgctgaatattttatggatacgcacggcgaga


BLASTn GenBank NR
Probe Info
Probe Sequence(5'-3') Probe X Probe Y Probe Interrogation
Position
Strandedness
GAAGCACGTCGACTGAAGAAGGCAT 586 341 2024 Antisense
GAGGACCATTATACGGTTTCGAGCT 599 403 2231 Antisense
GGTTTCGAGCTGGTTGAACTCTCAA 619 505 2245 Antisense
GAACTCTCAACAATTCCCGATGAAG 326 349 2260 Antisense
GATGAAGTTATCGAGCATGCTCAAT 140 411 2278 Antisense
GCTCAATCACTAGCAACCGAACTTA 660 301 2296 Antisense
AGCAACCGAACTTAGAGCAAATGTC 166 77 2307 Antisense
GAGACTATGACTCAGAACGCCGTAG 407 393 2345 Antisense
CAGAACGCCGTAGGATCAAAGTCTA 2 201 2357 Antisense
ATCAAAGTCTACATGAACCATCGTT 223 25 2371 Antisense
TATTTTATGGATACGCACGGCGAGA 623 661 2413 Antisense
Sequence Source Affymetrix Proprietary Database