[Home] | [Total List]

[192560_at] testis-specific protein TPX-1 like

Description F49E11.6 /REP_DB=WormBase Gene ID /WP=CE10802 /TR=Q93746 /GB=CAA94350.1 /SUBMIT=HINXTON /CHR=4 /FEA=Sanger Annotation /DEF=testis-specific protein TPX-1 like
Cluster 6grp_total > 78      4grp_total > 02      6grp_total_sub > Increase      6grp_rule_based > S6      4grp_rule_based > L4      

Scale

Warning: fopen(./gnuplot/192560_at_1_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/192560_at_1_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/192560_at_2_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/192560_at_2_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252
G range Absolute graph Relative graph Expression Table Dauer Comp.
4 12412
1 2 3 4 range
A 210.4
(-2.9)
P
9.5
(-3)
A
13.6
(-3)
A
12237.5
(3)
P
12228
B 171.4
(-2.9)
P
7.6
(-3)
A
49.6
(-3)
A
12419.2
(3)
P
12412
C 241.5
(-2.9)
P
38.6
(-3)
A
37.3
(-3)
A
11040.4
(3)
P
11003
avr 207.8
(-2.9)
18.6
(-3)
33.5
(-3)
11899
(3)
11880

Warning: fopen(./gnuplot/192560_at_dSignal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/192560_at_dSignal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

1 : 1 state (S1, L1)
2 : dauer (ST, LT)
6 23089
1 2 3 4 5 6 range
A 48.9
(-3)
A
5.3
(-3)
A
31.3
(-3)
A
784.8
(-2.8)
P
9771.7
(-0.5)
P
23094.3
(3)
P
23089
B 8.1
(-3)
A
11.9
(-3)
A
15.5
(-3)
A
590.6
(-2.8)
P
11111.4
(0.3)
P
20152.8
(3)
P
20145
C 28.2
(-3)
A
21
(-3)
A
10.7
(-3)
A
623.4
(-2.8)
P
9632.3
(-0.4)
P
22463.8
(3)
P
22453
avr 28.4
(-3)
12.7
(-3)
19.2
(-3)
666.3
(-2.8)
10171.8
(-0.2)
21903.6
(3)
21891
No Scale

Warning: fopen(./gnuplot/192560_at_1_No_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/192560_at_1_No_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/192560_at_2_No_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/192560_at_2_No_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252
G range Absolute graph Relative graph Expression Table Dauer Comp.
4 2645
1 2 3 4 range
A 76.6
(-2.8)
P
2.1
(-3)
A
3.6
(-3)
A
1791.3
(3)
P
1789
B 54.6
(-2.9)
P
1.9
(-3)
A
11.5
(-3)
A
2646.5
(3)
P
2645
C 79.9
(-2.8)
P
11.1
(-3)
A
13
(-3)
A
1861.6
(3)
P
1851
avr 70.4
(-2.8)
5
(-3)
9.4
(-3)
2099.8
(3)
2095

Warning: fopen(./gnuplot/192560_at_dNo_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/192560_at_dNo_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

1 : 1 state (S1, L1)
2 : dauer (ST, LT)
6 7518
1 2 3 4 5 6 range
A 9
(-3)
A
1.9
(-3)
A
6.8
(-3)
A
199
(-2.8)
P
2948.7
(0.1)
P
5622.7
(3)
P
5621
B 2.8
(-3)
A
4
(-3)
A
3.8
(-3)
A
156.4
(-2.9)
P
4514.4
(0.6)
P
7514.9
(3)
P
7512
C 10.4
(-3)
A
6.4
(-3)
A
2.7
(-3)
A
125.4
(-2.9)
P
3116.9
(-0.5)
P
7519.9
(3)
P
7517
avr 7.4
(-3)
4.1
(-3)
4.4
(-3)
160.3
(-2.9)
3526.7
(0.1)
6885.8
(3)
6882
NetAffx Links Cluster Members
Consensus/Exemplar
GeneChip Array Information
Probe Set ID 192560_at
GeneChip Array C. elegans Genome Array
Organism Common Name Nematode
Probe Design Information
Transcript ID(Array Design) affy.Ce.9879
Sequence Type Exemplar sequence
Representative Public ID F49E11.6 NCBI
Target Description F49E11.6 /REP_DB=WormBase Gene ID /WP=CE10802 /TR=Q93746 /GB=CAA94350.1 /SUBMIT=HINXTON /CHR=4 /FEA=Sanger Annotation /DEF=testis-specific protein TPX-1 like
Cluster Evidence This cluster is supported by a Sanger Annotation.
Annotation Method Description
Annotation Description This probe set was annotated using the Matching Probes based pipeline to a RefSeq identifier using 1 transcript(s).
Annotation Grade This is a grade A annotation.
Annotation Transcript Cluster (# of Matching Probes) NM_070098(11)
Transcript Assignments
Representative
Transcript
Description Matching Probes Related Probesets by Grade
NM_070098 NCBI Caenorhabditis elegans F49E11.6 (F49E11.6) mRNA, complete cds. 11/11 None
SNAP00000011573 ENSEMBL cdna:SNAP chromosome:CEL140:IV:13051347:13052119:1 11/11 None
F49E11.6 ENSEMBL cdna:known chromosome:CEL140:IV:13051347:13052119:1 gene:F49E11.6 11/11 None
Annotation Notes
Cross Hybridizing mRNA Matched Probes Nature of Assignment Related Probesets by Grade
GENEFINDER00000011582 7/11 Cross Hyb Matching Probes None
Genomic Alignment of Consensus/Exemplar Sequence
Assembly Wormbase March 2004
Alignment(s)
Position Identity Coverage Cytoband
chrIV:13051352-13052125(+) 100.0 100.0
Public Domain and Genome References
Gene Title testis-specific protein TPX-1 like
Ensembl F49E11.6
Entrez Gene 186050 Entrez gene
SwissProt Q93746 EMBL-EBI
WormBase CE10802 Wormbase
Functional Annotations
Gene Ontology
GO Cellular Component (view graph)
ID Description Evidence Links
5576 extracellular region inferred from electronic annotation QuickGO AmiGO
Protein Similarities
Method ID Description E-Value
blast CAA94350 Hypothetical protein F49E11.6 [Caenorhabditis elegans] ref|NP_502499.1| F49E11.6 [Caenorhabditis elegans] 1.0E-123
blast CAE58674 Hypothetical protein CBG01847 [Caenorhabditis briggsae] 2.0E-82
blast CAA94335 Hypothetical protein C39E9.2 [Caenorhabditis elegans] ref|NP_502506.1| C39E9.2 [Caenorhabditis elegans] 9.0E-81
Protein Domains
Database ID Description E-Value
Pfam IPR001283 EMBL-EBI Allergen V5/Tpx-1 related 4.4E-66
Sequence
Target Sequence
>C. ELEGANS:192560_AT
ctgtatcgcaggagtcttctcccagttcaccagtactggccaacaagcaatcgtggatgc
ccacaataaattgagatcttcaattgccaaaggaacctatgttgccaagggaacaactca
aaagtctggctcaaacatgcgcaaaattaaatgggatgcaacagttgctacatctgctca
aaactatgccaatacctgcccaactggacactctcagggttctggatatggagagaattt
gtattggtattggacttctggaacaattggaaacctcgatacatttggaccagccgcatc
ttcatcctgggaatccgaattccagcaatatggatggacatctaacactcttgacatgaa
tactttcaatactggaatcggacacgctactcaaatggcctgggctaacacttttgccat
tggatgtggagttaagaactgtggaaaagatccttcaaatggatataacaaagttgcagt
tgtctgtcaatacaaaactcctggaaactacttgaatcagccaatctatcaacaaggaac
cacttgcgcggcttg


BLASTn GenBank NR
Probe Info
Probe Sequence(5'-3') Probe X Probe Y Probe Interrogation
Position
Strandedness
CTGTATCGCAGGAGTCTTCTCCCAG 556 239 39 Antisense
TTCTCCCAGTTCACCAGTACTGGCC 346 611 55 Antisense
GCAACAGTTGCTACATCTGCTCAAA 468 319 196 Antisense
TCAAAACTATGCCAATACCTGCCCA 614 629 216 Antisense
CCAACTGGACACTCTCAGGGTTCTG 656 275 238 Antisense
ACCTCGATACATTTGGACCAGCCGC 445 87 311 Antisense
CGCATCTTCATCCTGGGAATCCGAA 638 253 333 Antisense
GGATGGACATCTAACACTCTTGACA 488 515 370 Antisense
CGCTACTCAAATGGCCTGGGCTAAC 366 253 423 Antisense
GCCTGGGCTAACACTTTTGCCATTG 398 283 436 Antisense
AACAAGGAACCACTTGCGCGGCTTG 212 133 569 Antisense
Sequence Source Affymetrix Proprietary Database