[Home] | [Total List]

[192455_at] Zinc finger, C4 type (two domains)

Description C54C8.1 /REP_DB=WormBase Gene ID /WP=CE08964 /TR=O17706 /GB=CAB05462.1 /SUBMIT=HINXTON /CHR=1 /FEA=Sanger Annotation /DEF=Zinc finger, C4 type (two domains)
Cluster 6grp_total > 89      4grp_total > 06      6grp_cgc > 79      6grp_cgc_sub > Da      

Scale

Warning: fopen(./gnuplot/192455_at_1_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/192455_at_1_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/192455_at_2_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/192455_at_2_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252
G range Absolute graph Relative graph Expression Table Dauer Comp.
4 39
1 2 3 4 range
A 6.8
(-2.5)
A
3.5
(-3)
A
6.9
(-2.4)
A
40.1
(3)
A
37
B 26.2
(3)
A
1.4
(-3)
A
13.9
(0)
A
19.5
(1.4)
A
25
C 10.8
(-0.7)
A
1.5
(-3)
A
18.4
(1.2)
A
25.6
(3)
A
24
avr 14.6
(-0.1)
2.1
(-3)
13.1
(-0.5)
28.4
(3)
26

Warning: fopen(./gnuplot/192455_at_dSignal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/192455_at_dSignal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

1 : 1 state (S1, L1)
2 : dauer (ST, LT)
6 27
1 2 3 4 5 6 range
A 1.6
(-3)
A
3
(-2.7)
A
1.9
(-2.9)
A
8.3
(-1.5)
A
8.8
(-1.4)
A
27.8
(3)
A
26
B 0.5
(-3)
A
15.6
(3)
A
0.8
(-2.9)
A
1
(-2.8)
A
7.7
(-0.1)
A
2.2
(-2.3)
A
15
C 1
(-3)
A
3
(-2.1)
A
3.4
(-1.9)
A
1.5
(-2.8)
A
14
(3)
A
2.4
(-2.4)
A
13
avr 1
(-3)
7.2
(0.8)
2
(-2.4)
3.6
(-1.4)
10.2
(2.6)
10.8
(3)
10
No Scale

Warning: fopen(./gnuplot/192455_at_1_No_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/192455_at_1_No_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/192455_at_2_No_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/192455_at_2_No_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252
G range Absolute graph Relative graph Expression Table Dauer Comp.
4 8
1 2 3 4 range
A 2.5
(-1)
A
0.8
(-3)
A
1.8
(-1.8)
A
5.9
(3)
A
5
B 8.3
(3)
A
0.3
(-3)
A
3.2
(-0.8)
A
4.2
(-0.1)
A
8
C 3.6
(0.2)
A
0.4
(-3)
A
6.4
(3)
A
4.3
(0.9)
A
6
avr 4.8
(3)
0.5
(-3)
3.8
(1.6)
4.8
(3)
4

Warning: fopen(./gnuplot/192455_at_dNo_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/192455_at_dNo_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

1 : 1 state (S1, L1)
2 : dauer (ST, LT)
6 7
1 2 3 4 5 6 range
A 0.3
(-3)
A
1.1
(-2.3)
A
0.4
(-2.9)
A
2.1
(-1.3)
A
2.7
(-0.8)
A
6.8
(3)
A
7
B 0.2
(-3)
A
5.2
(3)
A
0.2
(-3)
A
0.3
(-2.9)
A
3.1
(0.5)
A
0.8
(-2.3)
A
5
C 0.4
(-2.9)
A
0.9
(-2.1)
A
0.9
(-2.1)
A
0.3
(-3)
A
4.5
(3)
A
0.8
(-2.3)
A
4
avr 0.3
(-3)
2.4
(1.1)
0.5
(-2.6)
0.9
(-1.8)
3.4
(3)
2.8
(1.8)
3
NetAffx Links Cluster Members
Consensus/Exemplar
GeneChip Array Information
Probe Set ID 192455_at
GeneChip Array C. elegans Genome Array
Organism Common Name Nematode
Probe Design Information
Transcript ID(Array Design) affy.Ce.2167
Sequence Type Exemplar sequence
Representative Public ID C54C8.1 NCBI
Target Description C54C8.1 /REP_DB=WormBase Gene ID /WP=CE08964 /TR=O17706 /GB=CAB05462.1 /SUBMIT=HINXTON /CHR=1 /FEA=Sanger Annotation /DEF=Zinc finger, C4 type (two domains)
Cluster Evidence This cluster is supported by a Sanger Annotation.
Annotation Method Description
Annotation Description This probe set was annotated using the Matching Probes based pipeline to a RefSeq identifier using 1 transcript(s).
Annotation Grade This is a grade A annotation.
Annotation Transcript Cluster (# of Matching Probes) NM_060755(11)
Transcript Assignments
Representative
Transcript
Description Matching Probes Related Probesets by Grade
NM_060755 NCBI Caenorhabditis elegans C54C8.1 (C54C8.1) mRNA, complete cds. 11/11 None
GENEFINDER00000034218 ENSEMBL cdna:GeneFinder chromosome:CEL140:I:12450420:12451849:1 11/11 None
SNAP00000034206 ENSEMBL cdna:SNAP chromosome:CEL140:I:12450917:12454589:1 11/11 None
C54C8.1 ENSEMBL cdna:known chromosome:CEL140:I:12450420:12451849:1 gene:C54C8.1 11/11 None
Annotation Notes
There are no noteworthy cross hybridizing mRNAs found for this probe set.
Genomic Alignment of Consensus/Exemplar Sequence
Assembly Wormbase March 2004
Alignment(s)
Position Identity Coverage Cytoband
chrI:12450350-12451780(+) 100.0 100.0
Public Domain and Genome References
Gene Title Zinc finger, C4 type (two domains)
Gene Symbol nhr-169
Ensembl C54C8.1
Entrez Gene 183768 Entrez gene
SwissProt O17706 EMBL-EBI
WormBase CE36114 Wormbase
Functional Annotations
Gene Ontology
GO Biological Process (view graph)
ID Description Evidence Links
6355 regulation of transcription, DNA-dependent inferred from electronic annotation QuickGO AmiGO
GO Cellular Component (view graph)
ID Description Evidence Links
5634 nucleus inferred from electronic annotation QuickGO AmiGO
GO Molecular Function (view graph)
ID Description Evidence Links
3700 transcription factor activity inferred from electronic annotation QuickGO AmiGO
3707 steroid hormone receptor activity inferred from electronic annotation QuickGO AmiGO
Protein Similarities
Method ID Description E-Value
blast CAB05462 Hypothetical protein C54C8.1 [Caenorhabditis elegans] ref|NP_493156.2| C54C8.1 [Caenorhabditis elegans] 0.0
blast CAB05464 Hypothetical protein C54C8.2 [Caenorhabditis elegans] ref|NP_493157.1| C54C8.2 [Caenorhabditis elegans] 0.0
blast CAB04495 Hypothetical protein F56H6.6 [Caenorhabditis elegans] ref|NP_493107.1| F56H6.6 [Caenorhabditis elegans] 1.0E-135
blast CAB05622 Hypothetical protein T15D6.6 [Caenorhabditis elegans] ref|NP_493137.2| Nuclear Hormone Receptor family member (nhr-77) [Caenorhabditis elegans] 1.0E-122
blast CAE61403 Hypothetical protein CBG05262 [Caenorhabditis briggsae] 1.0E-118
blast CAB04030 Hypothetical protein E03H4.6 [Caenorhabditis elegans] ref|NP_493149.1| E03H4.6 [Caenorhabditis elegans] 1.0E-103
Protein Domains
Database ID Description E-Value
Pfam IPR000536 EMBL-EBI Ligand-binding domain of nuclear hormone receptor 0.0033
Pfam IPR001628 EMBL-EBI Zn-finger, C4-type steroid receptor 2.6E-14
Pfam IPR000536 EMBL-EBI Ligand-binding domain of nuclear hormone receptor 0.0064
Sequence
Target Sequence
>C. ELEGANS:192455_AT
aatcgtttgagtttatctccacttactgaattaccgattaacgatgaaatggataacaca
ttgaatattaggacaaaagaagaattatttgaaatagtcagctaccaaagtaaggttgca
gcggaaacatgcagaacttgtcctggagttgatttacttgataatcgggatattctgatt
cttcggaaatatttccaattttcaaatatttggattgaatctacatggaaatattggttc
tcaaatgatttttcaaatgatactgaaaaatttgacataaaattaatggaattcataggt
caagtcaaatcaaccctgcttatttccctttctcggttgaaatttaatatctttgaattc
acagcattcaaagcaatttgcatctggaaattggtataccatgagacgagcagagccatg
aaaattgttgcacaagagcattatgaaggtgttacaaaagcattaatcagttactatcag
acttatactttgctggactcaatggaaattgcaattcgagtcggtgaaattacgttgctg
gtatcttcagtttttcaa


BLASTn GenBank NR
Probe Info
Probe Sequence(5'-3') Probe X Probe Y Probe Interrogation
Position
Strandedness
AATCGTTTGAGTTTATCTCCACTTA 29 169 391 Antisense
TCTCCACTTACTGAATTACCGATTA 498 607 406 Antisense
AGCTACCAAAGTAAGGTTGCAGCGG 459 79 490 Antisense
CATGCAGAACTTGTCCTGGAGTTGA 650 209 518 Antisense
GATAATCGGGATATTCTGATTCTTC 45 423 550 Antisense
AGTCAAATCAACCCTGCTTATTTCC 558 61 693 Antisense
GGTATACCATGAGACGAGCAGAGCC 435 503 783 Antisense
GTTACTATCAGACTTATACTTTGCT 261 445 860 Antisense
GACTTATACTTTGCTGGACTCAATG 54 373 870 Antisense
GAGTCGGTGAAATTACGTTGCTGGT 74 401 908 Antisense
GTTGCTGGTATCTTCAGTTTTTCAA 36 441 924 Antisense
Sequence Source Affymetrix Proprietary Database