[Home] | [Total List]

[192323_at] alpha-B-crystallin

Description F38E11.2 /REP_DB=WormBase Gene ID /WP=CE03294 /GEN=hsp-12.6 /TR=Q20165 /GB=CAA92771.1 /SUBMIT=HINXTON /CHR=4 /FEA=Sanger Annotation /DEF=alpha-B-crystallin
Cluster 6grp_total > 87      4grp_total > 02      6grp_cgc > 59      6grp_cgc_sub > Da      6grp_total_sub > Increase      6grp_rule_based > S6      4grp_rule_based > L4      

Scale

Warning: fopen(./gnuplot/192323_at_1_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/192323_at_1_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/192323_at_2_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/192323_at_2_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252
G range Absolute graph Relative graph Expression Table Dauer Comp.
4 14587
1 2 3 4 range
A 153
(-2.9)
P
15.2
(-3)
A
2.2
(-3)
A
14008.6
(3)
P
14006
B 125.8
(-2.9)
P
2.4
(-3)
A
1.6
(-3)
A
14091.4
(3)
P
14090
C 134.2
(-2.9)
P
5.6
(-3)
A
2.6
(-3)
A
14588.1
(3)
P
14586
avr 137.7
(-2.9)
7.7
(-3)
2.1
(-3)
14229.4
(3)
14227

Warning: fopen(./gnuplot/192323_at_dSignal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/192323_at_dSignal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

1 : 1 state (S1, L1)
2 : dauer (ST, LT)
6 5750
1 2 3 4 5 6 range
A 59.1
(-2.9)
A
5.4
(-3)
A
113.6
(-2.9)
P
602.2
(-2.3)
P
2528.5
(-0.1)
P
5146.4
(3)
P
5141
B 46.7
(-3)
A
51.9
(-3)
M
112.3
(-2.9)
P
478.9
(-2.5)
P
2557.4
(-0.1)
P
5244.7
(3)
P
5198
C 77.3
(-3)
P
50.2
(-3)
A
68.2
(-3)
A
640.4
(-2.4)
P
2521.7
(-0.4)
P
5755.6
(3)
P
5705
avr 61
(-3)
35.8
(-3)
98
(-2.9)
573.8
(-2.4)
2535.9
(-0.2)
5382.2
(3)
5346
No Scale

Warning: fopen(./gnuplot/192323_at_1_No_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/192323_at_1_No_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/192323_at_2_No_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/192323_at_2_No_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252
G range Absolute graph Relative graph Expression Table Dauer Comp.
4 3003
1 2 3 4 range
A 55.7
(-2.8)
P
3.3
(-3)
A
0.6
(-3)
A
2050.6
(3)
P
2050
B 40.1
(-2.9)
P
0.6
(-3)
A
0.4
(-3)
A
3002.9
(3)
P
3003
C 44.4
(-2.9)
P
1.6
(-3)
A
0.9
(-3)
A
2459.8
(3)
P
2459
avr 46.7
(-2.9)
1.8
(-3)
0.6
(-3)
2504.4
(3)
2504

Warning: fopen(./gnuplot/192323_at_dNo_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/192323_at_dNo_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

1 : 1 state (S1, L1)
2 : dauer (ST, LT)
6 1954
1 2 3 4 5 6 range
A 10.9
(-3)
A
1.9
(-3)
A
24.7
(-2.9)
P
152.7
(-2.3)
P
763
(0.7)
P
1253
(3)
P
1251
B 16.2
(-3)
A
17.3
(-3)
M
27.3
(-3)
P
126.8
(-2.7)
P
1039
(0.2)
P
1955.7
(3)
P
1940
C 28.6
(-3)
P
15.3
(-3)
A
17.3
(-3)
A
128.8
(-2.6)
P
816
(-0.5)
P
1926.7
(3)
P
1911
avr 18.6
(-3)
11.5
(-3)
23.1
(-3)
136.1
(-2.6)
872.7
(0)
1711.8
(3)
1700
NetAffx Links Cluster Members
Consensus/Exemplar
GeneChip Array Information
Probe Set ID 192323_at
GeneChip Array C. elegans Genome Array
Organism Common Name Nematode
Probe Design Information
Transcript ID(Array Design) affy.Ce.8562
Sequence Type Exemplar sequence
Representative Public ID F38E11.2 NCBI
Target Description F38E11.2 /REP_DB=WormBase Gene ID /WP=CE03294 /GEN=hsp-12.6 /TR=Q20165 /GB=CAA92771.1 /SUBMIT=HINXTON /CHR=4 /FEA=Sanger Annotation /DEF=alpha-B-crystallin
Cluster Evidence This cluster is supported by a Sanger Annotation.
Annotation Method Description
Annotation Description This probe set was annotated using the Matching Probes based pipeline to a RefSeq identifier using 1 transcript(s).
Annotation Grade This is a grade A annotation.
Annotation Transcript Cluster (# of Matching Probes) NM_069267(11)
Transcript Assignments
Representative
Transcript
Description Matching Probes Related Probesets by Grade
NM_069267 NCBI Caenorhabditis elegans F38E11.2 (alpha-B-crystallin) mRNA, complete cds. 11/11 None
SNAP00000022710 ENSEMBL cdna:SNAP chromosome:CEL140:IV:9446362:9446861:-1 11/11 None
GENEFINDER00000022722 ENSEMBL cdna:GeneFinder chromosome:CEL140:IV:9446362:9446861:-1 11/11 None
F38E11.2 ENSEMBL cdna:known chromosome:CEL140:IV:9446362:9446861:-1 gene:F38E11.2 11/11 None
Annotation Notes
There are no noteworthy cross hybridizing mRNAs found for this probe set.
Genomic Alignment of Consensus/Exemplar Sequence
Assembly Wormbase March 2004
Alignment(s)
Position Identity Coverage Cytoband
chrIV:9446367-9446867(-) 100.0 100.0
Public Domain and Genome References
Gene Title alpha-B-crystallin
Gene Symbol hsp-12.6
Ensembl F38E11.2
Entrez Gene 177778 Entrez gene
SwissProt Q20165 EMBL-EBI
WormBase CE03294 Wormbase
Functional Annotations
Protein Similarities
Method ID Description E-Value
blast CAA92771 Hypothetical protein F38E11.2 [Caenorhabditis elegans] ref|NP_501668.1| F38E11.2 [Caenorhabditis elegans] gb|AAC47521.1| heat shock protein 12.6 [Caenorhabditis elegans] 1.0E-51
blast CAE74012 Hypothetical protein CBG21660 [Caenorhabditis briggsae] 5.0E-44
blast CAA92770 Hypothetical protein F38E11.1 [Caenorhabditis elegans] ref|NP_501667.1| F38E11.1 [Caenorhabditis elegans] 2.0E-31
Protein Domains
Database ID Description E-Value
Pfam IPR002068 EMBL-EBI Heat shock protein Hsp20 1.5E-9
Sequence
Target Sequence
>C. ELEGANS:192323_AT
gattggccacttcaaaagggagatggagttgtcaatgtcctcgacgacgatgatcacttc
gaagtaggcctagaagcccataacttcctcccaaaagagattgaagtcaagaacattgga
gaacttcttgaaatccatatggagcacaatgtaaagaaggattcatttggagatgtctct
cgtaacattactcgttgttacaaacttccaaagaatgttgatatgaagacaatcaagagc
aacttggattcacatggaat


BLASTn GenBank NR
Probe Info
Probe Sequence(5'-3') Probe X Probe Y Probe Interrogation
Position
Strandedness
GATTGGCCACTTCAAAAGGGAGATG 337 435 55 Antisense
GATGGAGTTGTCAATGTCCTCGACG 381 407 76 Antisense
GTCCTCGACGACGATGATCACTTCG 217 477 91 Antisense
GATGATCACTTCGAAGTAGGCCTAG 599 409 103 Antisense
GTAGGCCTAGAAGCCCATAACTTCC 64 331 118 Antisense
GCCCATAACTTCCTCCCAAAAGAGA 494 283 130 Antisense
GAACTTCTTGAAATCCATATGGAGC 612 349 175 Antisense
GGATTCATTTGGAGATGTCTCTCGT 478 509 213 Antisense
GATGTCTCTCGTAACATTACTCGTT 120 409 226 Antisense
CATTACTCGTTGTTACAAACTTCCA 25 213 240 Antisense
AGAGCAACTTGGATTCACATGGAAT 700 69 290 Antisense
Sequence Source Affymetrix Proprietary Database