[Home] | [Total List]

[192315_at]

Description F20D12.6 /REP_DB=WormBase Gene ID /WP=CE04436 /GEN=ceh-19 /TR=SW:Q19644 /GB=AAA81676.1 /SUBMIT=ST.LOUIS /CHR=4 /FEA=Sanger Annotation /DEF=homeobox protein
Cluster 6grp_total > 10      4grp_total > 06      6grp_cgc > 54      6grp_total_sub > Hat      

Scale

Warning: fopen(./gnuplot/192315_at_1_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/192315_at_1_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/192315_at_2_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/192315_at_2_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252
G range Absolute graph Relative graph Expression Table Dauer Comp.
4 151
1 2 3 4 range
A 38.7
(1.2)
A
5
(-3)
A
41.8
(1.6)
A
52.8
(3)
P
48
B 34.2
(-0.2)
A
5.7
(-3)
A
40.9
(0.5)
A
66.8
(3)
P
61
C 71.6
(-0.3)
A
10.6
(-2.8)
A
4.4
(-3)
A
155.1
(3)
P
151
avr 48.2
(-0.1)
7.1
(-3)
29
(-1.4)
91.6
(3)
85

Warning: fopen(./gnuplot/192315_at_dSignal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/192315_at_dSignal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

1 : 1 state (S1, L1)
2 : dauer (ST, LT)
6 42
1 2 3 4 5 6 range
A 9.4
(-3)
A
29.4
(0.4)
A
44.4
(3)
A
24.7
(-0.4)
A
30.8
(0.7)
A
35.4
(1.5)
A
35
B 38.6
(0.4)
A
51.6
(3)
A
22.1
(-3)
A
34.4
(-0.5)
A
33.8
(-0.6)
A
23.4
(-2.7)
A
30
C 47.6
(3)
A
30.5
(-2.6)
A
37.3
(-0.4)
A
29.4
(-3)
A
35.9
(-0.9)
A
32.6
(-1.9)
A
18
avr 31.9
(-1.1)
37.2
(3)
34.6
(1)
29.5
(-3)
33.5
(0.1)
30.5
(-2.2)
8
No Scale

Warning: fopen(./gnuplot/192315_at_1_No_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/192315_at_1_No_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/192315_at_2_No_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/192315_at_2_No_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252
G range Absolute graph Relative graph Expression Table Dauer Comp.
4 25
1 2 3 4 range
A 14.1
(3)
A
1.1
(-3)
A
10.9
(1.5)
A
7.7
(0)
P
13
B 10.9
(1.5)
A
1.4
(-3)
A
9.5
(0.8)
A
14.2
(3)
P
13
C 23.7
(2.4)
A
3
(-2.6)
A
1.5
(-3)
A
26.2
(3)
P
25
avr 16.2
(3)
1.8
(-3)
7.3
(-0.7)
16
(2.9)
14

Warning: fopen(./gnuplot/192315_at_dNo_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/192315_at_dNo_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

1 : 1 state (S1, L1)
2 : dauer (ST, LT)
6 16
1 2 3 4 5 6 range
A 1.7
(-3)
A
10.4
(3)
A
9.7
(2.5)
A
6.3
(0.2)
A
9.3
(2.2)
A
8.6
(1.8)
A
9
B 13.4
(1.1)
A
17.2
(3)
A
5.4
(-3)
A
9.1
(-1.1)
A
13.7
(1.2)
A
8.7
(-1.3)
A
12
C 17.7
(3)
A
9.3
(-1.3)
A
9.5
(-1.2)
A
5.9
(-3)
A
11.6
(-0.1)
A
10.9
(-0.5)
A
12
avr 10.9
(1.4)
12.3
(3)
8.2
(-1.7)
7.1
(-3)
11.5
(2.1)
9.4
(-0.3)
5
NetAffx Links Cluster Members
Consensus/Exemplar
GeneChip Array Information
Probe Set ID 192315_at
GeneChip Array C. elegans Genome Array
Organism Common Name Nematode
Probe Design Information
Transcript ID(Array Design) affy.Ce.8440
Sequence Type Exemplar sequence
Representative Public ID F20D12.6 NCBI
Target Description F20D12.6 /REP_DB=WormBase Gene ID /WP=CE04436 /GEN=ceh-19 /TR=SW:Q19644 /GB=AAA81676.1 /SUBMIT=ST.LOUIS /CHR=4 /FEA=Sanger Annotation /DEF=homeobox protein
Cluster Evidence This cluster is supported by a Sanger Annotation.
Annotation Method Description
Annotation Description This probe set was annotated using the Matching Probes based pipeline to a RefSeq identifier using 1 transcript(s).
Annotation Grade This is a grade A annotation.
Annotation Transcript Cluster (# of Matching Probes) NM_001027971(11)
Transcript Assignments
Representative
Transcript
Description Matching Probes Related Probesets by Grade
NM_001027971 NCBI Caenorhabditis elegans C.Elegans Homeobox family member (ceh-19) (ceh-19) mRNA, complete cds. 11/11 None
GENEFINDER00000004285 ENSEMBL cdna:GeneFinder chromosome:CEL140:IV:7953625:7955641:-1 11/11 None
F20D12.6b ENSEMBL cdna:known chromosome:CEL140:IV:7953625:7955788:-1 gene:F20D12.6 11/11 None
Annotation Notes
Cross Hybridizing mRNA Matched Probes Nature of Assignment Related Probesets by Grade
NM_001027970 8/11 Cross Hyb Matching Probes None
SNAP00000004280 2/11 Cross Hyb Matching Probes None
F20D12.6a 8/11 Cross Hyb Matching Probes None
Splice Variants
Entrez Total Refseq Isoforms Total Detected By This Probeset Refseq Probesets
177590 2 1 NM_001027971 192315_at (11)
Genomic Alignment of Consensus/Exemplar Sequence
Assembly Wormbase March 2004
Alignment(s)
Position Identity Coverage Cytoband
chrIV:7953630-7955794(-) 90.17 100.0
Public Domain and Genome References
Ensembl F20D12.6
Functional Annotations
Protein Similarities
Method ID Description E-Value
blast AAQ23123 C.elegans homeobox protein 19, isoform b [Caenorhabditis elegans] ref|NP_001023142.1| C.Elegans Homeobox family member (ceh-19) [Caenorhabditis elegans] sp|P26797|HM19_CAEEL Homeobox protein ceh-19 9.0E-88
blast AAQ23123 C.elegans homeobox protein 19, isoform b [Caenorhabditis elegans] ref|NP_001023142.1| C.Elegans Homeobox family member (ceh-19) [Caenorhabditis elegans] sp|P26797|HM19_CAEEL Homeobox protein ceh-19 1.0E-72
blast CAE70920 Hypothetical protein CBG17719 [Caenorhabditis briggsae] 3.0E-63
blast CAA77838 pceh16-1 protein [Caenorhabditis elegans] 4.0E-56
blast AAA81676 C.elegans homeobox protein 19, isoform a [Caenorhabditis elegans] ref|NP_001023141.1| C.Elegans Homeobox family member (ceh-19) [Caenorhabditis elegans] 6.0E-56
blast CAA77838 pceh16-1 protein [Caenorhabditis elegans] 1.0E-55
Protein Domains
Database ID Description E-Value
scop a.4.1.Homeodomain All alpha proteins; DNA/RNA-binding 3-helical bundle; Homeodomain-like; Homeodomain 1.99999996755032E-17
scop a.4.1.Homeodomain All alpha proteins; DNA/RNA-binding 3-helical bundle; Homeodomain-like; Homeodomain 3.00000003404354E-18
Pfam IPR001356 EMBL-EBI Homeobox 8.1E-29
Pfam IPR001356 EMBL-EBI Homeobox 8.1E-29
Sequence
Target Sequence
>C. ELEGANS:192315_AT
aagccaattggcaatgtttgctattgcaaatgatctgagaacaccaactcttgttgagtt
acaaatgcttttaggagtatcagctcgaaagcatgattacaagagaagcagaaaatctgt
ctgcgaaagaaaaccacgacaagcgtattcagcaagacagttggatagattggaaacgga
atttcaaactgacaaatatctgagtgtgaacaagagaatccaattgtctcagacattgaa
tctaactgagacccagataaaaacatggtttcaaaatagacgaacaaaatggaagaaaca
attaacatcatcaatacgtcaaatggtaaaagatgctccaacatccacgtcagttggtgt
tccttttcagtcactt


BLASTn GenBank NR
Probe Info
Probe Sequence(5'-3') Probe X Probe Y Probe Interrogation
Position
Strandedness
AAGCCAATTGGCAATGTTTGCTATT 191 149 168 Antisense
GATCTGAGAACACCAACTCTTGTTG 620 417 199 Antisense
AATGCTTTTAGGAGTATCAGCTCGA 34 167 231 Antisense
ATCTGTCTGCGAAAGAAAACCACGA 125 33 282 Antisense
AAACCACGACAAGCGTATTCAGCAA 548 125 298 Antisense
GAGAATCCAATTGTCTCAGACATTG 348 391 381 Antisense
GACATTGAATCTAACTGAGACCCAG 219 371 399 Antisense
ACAATTAACATCATCAATACGTCAA 465 115 465 Antisense
AAAAGATGCTCCAACATCCACGTCA 253 133 495 Antisense
ACATCCACGTCAGTTGGTGTTCCTT 37 107 508 Antisense
AGTTGGTGTTCCTTTTCAGTCACTT 54 63 519 Antisense
Sequence Source Affymetrix Proprietary Database