[Home] | [Total List]

[192314_s_at] zinc metallopeptidase (M1 family)

Description R03G8.6 /REP_DB=WormBase Gene ID /WP=CE18905 /TR=Q9XVV9 /GB=CAA93680.1 /SUBMIT=HINXTON /CHR=X /FEA=Sanger Annotation /DEF=zinc metallopeptidase (M1 family)
Cluster 6grp_total > 94      4grp_total > 08      6grp_total_sub > Hat      6grp_rule_based > S5      

Scale

Warning: fopen(./gnuplot/192314_s_at_1_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/192314_s_at_1_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/192314_s_at_2_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/192314_s_at_2_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252
G range Absolute graph Relative graph Expression Table Dauer Comp.
4 91
1 2 3 4 range
A 6.4
(-2.7)
A
9.1
(-2.6)
A
2.5
(-3)
A
93.6
(3)
A
91
B 4.4
(-3)
A
4.3
(-3)
A
42.8
(3)
A
5.9
(-2.8)
A
39
C 7.9
(-2.8)
A
6
(-3)
A
22.3
(-1.4)
A
66
(3)
A
60
avr 6.2
(-3)
6.5
(-3)
22.5
(-1)
55.2
(3)
49

Warning: fopen(./gnuplot/192314_s_at_dSignal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/192314_s_at_dSignal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

1 : 1 state (S1, L1)
2 : dauer (ST, LT)
6 104
1 2 3 4 5 6 range
A 7.7
(-2.7)
A
1.8
(-3)
A
4.5
(-2.8)
A
6.3
(-2.7)
A
106.2
(3)
A
9.6
(-2.6)
A
104
B 4.4
(-2.9)
A
24.2
(-1.5)
A
28.5
(-1.2)
A
3
(-3)
A
87.4
(3)
A
60.8
(1.1)
A
84
C 3.9
(-2.9)
A
23
(-1.1)
A
14.3
(-1.9)
A
2.9
(-3)
A
65.5
(3)
A
46
(1.1)
A
63
avr 5.3
(-2.9)
16.3
(-2.1)
15.8
(-2.1)
4.1
(-3)
86.4
(3)
38.8
(-0.5)
82
No Scale

Warning: fopen(./gnuplot/192314_s_at_1_No_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/192314_s_at_1_No_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/192314_s_at_2_No_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/192314_s_at_2_No_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252
G range Absolute graph Relative graph Expression Table Dauer Comp.
4 13
1 2 3 4 range
A 2.3
(-2.2)
A
2
(-2.4)
A
0.6
(-3)
A
13.7
(3)
A
13
B 1.4
(-2.8)
A
1.1
(-3)
A
9.9
(3)
A
1.3
(-2.9)
A
9
C 2.6
(-2.4)
A
1.7
(-3)
A
7.8
(0.9)
A
11.1
(3)
A
9
avr 2.1
(-2.6)
1.6
(-3)
6.1
(0.8)
8.7
(3)
7

Warning: fopen(./gnuplot/192314_s_at_dNo_Signal.dat) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

Warning: fopen(./gnuplot/192314_s_at_dNo_Signal.gnu) [function.fopen]: failed to open stream: Permission denied in /srv/www/htdocs/dauerdb/include/header.php on line 250

Warning: fwrite(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 251

Warning: fclose(): supplied argument is not a valid stream resource in /srv/www/htdocs/dauerdb/include/header.php on line 252

1 : 1 state (S1, L1)
2 : dauer (ST, LT)
6 35
1 2 3 4 5 6 range
A 1.4
(-2.8)
A
0.6
(-3)
A
1
(-2.9)
A
1.6
(-2.8)
A
32
(3)
A
2.3
(-2.7)
A
31
B 1.5
(-2.9)
A
8.1
(-1.7)
A
6.9
(-1.9)
A
0.8
(-3)
A
35.5
(3)
A
22.7
(0.8)
A
35
C 1.4
(-2.8)
A
7
(-1.1)
A
3.6
(-2.1)
A
0.6
(-3)
A
21.2
(3)
A
15.4
(1.3)
A
21
avr 1.4
(-2.9)
5.2
(-2.1)
3.8
(-2.4)
1
(-3)
29.6
(3)
13.5
(-0.4)
29
NetAffx Links Cluster Members
Consensus/Exemplar
Group Members
GeneChip Array Information
Probe Set ID 192314_s_at
GeneChip Array C. elegans Genome Array
Organism Common Name Nematode
Probe Design Information
Transcript ID(Array Design) affy.Ce.17925
Sequence Type Exemplar sequence
Representative Public ID R03G8.6 NCBI
Target Description R03G8.6 /REP_DB=WormBase Gene ID /WP=CE18905 /TR=Q9XVV9 /GB=CAA93680.1 /SUBMIT=HINXTON /CHR=X /FEA=Sanger Annotation /DEF=zinc metallopeptidase (M1 family)
Cluster Evidence This cluster is supported by a Sanger Annotation.
Annotation Method Description
Annotation Description This probe set was annotated using the Matching Probes based pipeline to a RefSeq identifier using 1 transcript(s).
Annotation Grade This is a grade A annotation.
Annotation Transcript Cluster (# of Matching Probes) NM_077774(11)
Transcript Assignments
Representative
Transcript
Description Matching Probes Related Probesets by Grade
NM_077774 NCBI Caenorhabditis elegans R03G8.6 (R03G8.6) mRNA, complete cds. 11/11 None
GENEFINDER00000031820 ENSEMBL cdna:GeneFinder chromosome:CEL140:X:13094556:13104866:-1 11/11 None
R03G8.6 ENSEMBL cdna:known chromosome:CEL140:X:13094478:13100365:-1 gene:R03G8.6 11/11 None
Annotation Notes
Cross Hybridizing mRNA Matched Probes Nature of Assignment Related Probesets by Grade
SNAP00000031814 1/11 Cross Hyb Matching Probes None
Genomic Alignment of Consensus/Exemplar Sequence
Assembly Wormbase March 2004
Alignment(s)
Position Identity Coverage Cytoband
chrX:13094555-13100338(-) 100.0 100.0
Public Domain and Genome References
Gene Title zinc metallopeptidase (M1 family)
Ensembl R03G8.6
Entrez Gene 181438 Entrez gene
SwissProt Q9XVV9 EMBL-EBI
WormBase CE18905 Wormbase
Functional Annotations
Gene Ontology
GO Biological Process (view graph)
ID Description Evidence Links
6508 proteolysis inferred from electronic annotation QuickGO AmiGO
GO Molecular Function (view graph)
ID Description Evidence Links
4179 membrane alanyl aminopeptidase activity inferred from electronic annotation QuickGO AmiGO
8237 metallopeptidase activity inferred from electronic annotation QuickGO AmiGO
8270 zinc ion binding inferred from electronic annotation QuickGO AmiGO
Protein Similarities
Method ID Description E-Value
blast CAA93680 Hypothetical protein R03G8.6 [Caenorhabditis elegans] ref|NP_510175.1| R03G8.6 [Caenorhabditis elegans] 0.0
blast CAA93681 Hypothetical protein R03G8.4 [Caenorhabditis elegans] ref|NP_510176.1| R03G8.4 [Caenorhabditis elegans] 0.0
blast CAE64729 Hypothetical protein CBG09516 [Caenorhabditis briggsae] 1.0E-151
Protein Domains
Database ID Description E-Value
Pfam IPR001930 EMBL-EBI Peptidase M1, membrane alanine aminopeptidase 1.0E-126
Pfam IPR001930 EMBL-EBI Peptidase M1, membrane alanine aminopeptidase 1.0E-126
Pfam IPR001930 EMBL-EBI Peptidase M1, membrane alanine aminopeptidase 1.0E-126
Sequence
Target Sequence
>C. ELEGANS:192314_S_AT
ggaacttgtggcagatgattcggttattatcaatgcaaactcgataggatactatgaagt
actttattccgacaaaatgtacgaaaaaatagccgaacaagttgcaataaatgtttcgag
gtattccgtcaattctcttcgtcgaacgcttcatgatgtttttcgttattcacgagacgg
attgactccgtttcacaatgcctttatcattgcatatgttcttgtatttggagaaaatga
aattctccgtcacgaatctgtgttgtaccttgtggacgcagtttacaatactaataacaa
aagtattgtaaatagtaaggacatcgaaacagtaaagggacttgtaaatcaaatcgaaaa
ttttgagttgtttccaaaatgtgtacagtctcaaacattttcgagttgttatcaaaaaag
aattccacaaaatataaatttgcgcgcaatcatgcaattgaaactgagtcaaaacacaat
ggatctgattgtggcatgggctga


BLASTn GenBank NR
Probe Info
Probe Sequence(5'-3') Probe X Probe Y Probe Interrogation
Position
Strandedness
GGAACTTGTGGCAGATGATTCGGTT 337 529 1632 Antisense
GAGGTATTCCGTCAATTCTCTTCGT 356 403 1749 Antisense
ATTCTCTTCGTCGAACGCTTCATGA 698 9 1763 Antisense
CGCTTCATGATGTTTTTCGTTATTC 392 253 1778 Antisense
ACGAGACGGATTGACTCCGTTTCAC 69 91 1803 Antisense
CTCCGTTTCACAATGCCTTTATCAT 153 235 1817 Antisense
GCCTTTATCATTGCATATGTTCTTG 308 281 1831 Antisense
GAAATTCTCCGTCACGAATCTGTGT 558 363 1870 Antisense
GAATCTGTGTTGTACCTTGTGGACG 644 327 1885 Antisense
GTACAGTCTCAAACATTTTCGAGTT 190 461 2014 Antisense
TGGATCTGATTGTGGCATGGGCTGA 317 551 2111 Antisense
Sequence Source Affymetrix Proprietary Database